Nikolas Karvelas, MD @NikKarvel
MD from @uoaofficial, studying cerebrovascular disease in @IcahnMountSinai 🧠 Also interested in: literature, archaeology, electronic music, mischief New York, USA Joined December 2023-
Tweets17
-
Followers129
-
Following573
-
Likes450
This study provides Class II evidence that among those aged 65 years or older, statin initiation was associated with a reduced risk of #Alzheimer disease, especially in the presence of an APOE-e4 allele: bit.ly/3VWTQnT
Rare diseases pose a challenge for omics studies, which require hundreds of samples. With our work, we provide a novel framework for proteomics discovery, that uncovers central mechanisms of #CADASIL! 🔬 Congrats to lead author Jonah Keller, and the whole team! 🎉
Rare diseases pose a challenge for omics studies, which require hundreds of samples. With our work, we provide a novel framework for proteomics discovery, that uncovers central mechanisms of #CADASIL! 🔬 Congrats to lead author Jonah Keller, and the whole team! 🎉
AATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAGAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAAAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTGA
Read the three winning entries from the Brain essay competition, on the illusion of consciousness (tinyurl.com/ntdkbvuv), the origins of migraine stigma (tinyurl.com/mtkzu9f2), and a sci-fi view of the future of gene repair technology (tinyurl.com/2crc9m7d).
So grateful I had the chance to lead this work. Understanding the molecular basis of common pathologies (such as ePVS) is crucial for better diagnostics and therapies for cerebral small vessel disease. Thank you to @FannyElahi, the team and of course the #CADASIL community! 🧠
So grateful I had the chance to lead this work. Understanding the molecular basis of common pathologies (such as ePVS) is crucial for better diagnostics and therapies for cerebral small vessel disease. Thank you to @FannyElahi, the team and of course the #CADASIL community! 🧠
Interesting how the exact same amount of steps has been shown to ward off dementia! jamanetwork.com/journals/jaman…
Interesting how the exact same amount of steps has been shown to ward off dementia! jamanetwork.com/journals/jaman…
“Police cordon holding back Beatles fans outside the London Pavillion at the premiere of “Let It Be” (1970), illustrating the concept of inhibitory restraint around a seizure focus.” Very imaginative cover. You can’t just “let it be” when it comes to seizure activity!
“Police cordon holding back Beatles fans outside the London Pavillion at the premiere of “Let It Be” (1970), illustrating the concept of inhibitory restraint around a seizure focus.” Very imaginative cover. You can’t just “let it be” when it comes to seizure activity!
Honored to be involved in rare disease research (CADASIL) and serve this community! Rare diseases are not as rare as we think, even more so considering how underdiagnosed they are. Let’s make an impact this #RareDiseaseDay2024 #CADASIL
Honored to be involved in rare disease research (CADASIL) and serve this community! Rare diseases are not as rare as we think, even more so considering how underdiagnosed they are. Let’s make an impact this #RareDiseaseDay2024 #CADASIL
In this case series of 15 patients with severe autoimmune disease, selective deep depletion of B lymphocytes with CD19 CAR T-cell therapy was effective in achieving clinical remission. Read the full article: nej.md/3UMQcMH
DEEP TENDON REFLEXES ARE NEITHER DEEP NOR TENDON REFLEXES
What a beautiful view of the Empire State Building! People, monuments and buildings across America showed their support for heart health and wellbeing today. We wore red for YOU! Who do you Go Red for? #HeartMonth #WearRedDay #NationofLifesavers
Efficient enzyme-free isolation of brain-derived extracellular vesicles biorxiv.org/cgi/content/sh… #bioRxiv
Groundbreaking work! Excited to see how it will be translated in the context of neurological disease
Groundbreaking work! Excited to see how it will be translated in the context of neurological disease
Some scientists would rather share their toothbrush with a colleague than discuss their ideas. But those that do..
Sunday Punday @ImmunityCP you are on a roll
Severe intracerebral hemorrhage causes tissue compliance as an intracranial pressure compensatory mechanism in aged hypertensive rats @Psych_UAlberta @ualbertaScience @KalisvaartAnna @casswilkinson10 ahajrnls.org/3TEuQAN
Do you know the milestones of biomarker evolution in Alzheimer’s disease? Will we learn from this experience as we pivot toward Parkinson? Nice paper by Mankhong and colleagues mdpi.com/2227-9059/10/4… and discussion at Parkinsonsecrets.com
Inaya Holquist @IHolquist92114
70 Followers 5K Following
Jon Hershon @jonathanhershon
2K Followers 2K Following CEO @PathwayMedical // AI-driven clinical decision support
Maude Wagner, PhD @maude_wagner2
951 Followers 976 Following Assistant Professor in Biostatistics, @rushalzheimers | Alumni, L'Oréal-@UNESCO @4womeninscience | Executive member, @DesignDataPIA | #rstat enthusiast ⚜️
Klara Memos @klara_memo
44 Followers 5K Following
Joy Fees @JoyFees11
809 Followers 1K Following
Franchesca Varuzzo @varuzzo62882
91 Followers 5K Following
Sharron Girdner @SharroGirdn
61 Followers 5K Following
Josie @josiesmalls99
195 Followers 3K Following
Poppy-may Alwazan @p_alwaz
33 Followers 5K Following
Sherrill Zee @SherrillZe69201
87 Followers 5K Following
bellie @lilbellie
345 Followers 595 Following Success usually comes to those who are too busy looking for it.
Xima García @ximagg
223 Followers 786 Following
Angeliki G. Filippato.. @agfilippatou
714 Followers 1K Following 🇬🇷 in 🇺🇸 | MD @uoaofficial | Executive Chief Neurology Resident @hopkinsneurons | Future #Neuroimmunology Fellow @hopkinsneurons 🧠👁
jpreventionalzheimer @jpreventionalz1
2K Followers 1K Following
Joshua Elkington @elkingtonxy
25K Followers 5K Following Founder and General Partner at Axial @axialxyz
Myah Dehler @MyahDehler12153
54 Followers 5K Following
Masud Husain @MasudHusain
5K Followers 1K Following Professor of Neurology & Cognitive Neuroscience @UniofOxford, Editor-in-Chief @Brain1878, Fellow @NewCollegeOx
Paul Jerome Lamont @PAULJLAMONT
740 Followers 3K Following Committed to solve Alzheimer's syndrome. 🇳🇿🇺🇸🇦🇺🇮🇹
Taleen Endlich @endl_tal
63 Followers 5K Following
Ying Wentworth @wentwo_yi
37 Followers 5K Following
Shannan Lenihan @lenih_shan
55 Followers 5K Following
Wendy Taylor @TaylorWend3125
39 Followers 2K Following
Katheleen Gbur @gb_kathele
72 Followers 5K Following
Christos Ganos @ChristosGanos
2K Followers 733 Following Movement Disorders, Neuropsychiatry, Sexual Medicine & Health - Freigeist Fellow of the VolkswagenStiftung - he/him 🏳️⚧️ ally
Verla Vosquez @vosq_ve
86 Followers 5K Following
International Society.. @isftd
1K Followers 1K Following We are a non-profit scientific society focused on FTD. ISFTD2024 Conference will be in Amsterdam https://t.co/0I1HLSno52
Rauch Lab @Rauch_Lab
217 Followers 376 Following UMass Amherst * Biochemistry and Molecular Biology * Protein misfolding * tau * neurodegeneration
Michael Gitcho @MGitcho
171 Followers 322 Following Neuroscientist investigating mechanisms of neurodegeneration in Alzheimer's disease, frontotemporal dementia, and amyotrophic lateral sclerosis.
Eleonora Ipson @ips_eleono
33 Followers 5K Following
Mica Schachter, MD @neurona_critica
1K Followers 687 Following Neurologist @EmoryNeurology - Neurocritical Care Fellow @EmoryNeuroCrit 🇦🇷🇺🇸 Check my IG posts ⬇️
Carrie Pasquarello @glosecresources
10K Followers 10K Following Founder & CEO @glosecresources Empowering people with community awareness prevention programs Dedicated to safety and security where we work, live, & travel
Mighty @ngdpGdTz4MYEY7D
41 Followers 1K Following I am a lively and cheerful girl who would like to meet a good friend.
Malgorzata Delabarre @MalgorzaDelaba
70 Followers 5K Following
kate foley, phd @kateeeemily
770 Followers 760 Following Postdoc in the @wilcocklab studying the effects of anti-AB therapy on the cerebrovasculature 🧠 & volunteer foster coordinator for @pittieposseME🐾
Aurore Petrouits @APetrouits22633
93 Followers 5K Following
Miriam Broida @broi_miri
51 Followers 5K Following
Vivian Perreira @vivian_per41863
87 Followers 5K Following
Iris Einspahr @IEinspahr97837
77 Followers 5K Following
Mar Stehney @MarStehn
45 Followers 5K Following
Noel Mickel @MickelNoel17841
72 Followers 5K Following
Kristophe Diaz, PhD @KristopheDiaz
4K Followers 4K Following I lead @CurePSP as its ED & CSO #neurodegeneration #partnerships - #neurotwitter https://t.co/okt78bSLm8
Rosemary @carter18rosemar
943 Followers 3K Following
Karolyn Fye @KarolyFye
31 Followers 5K Following
Audrey Ferenz @fer_aud
79 Followers 5K Following
Dr. Malu Tansey @MaluTansey
7K Followers 5K Following Stanford, UTSW, Latina, mother, daughter. Immunity inflammation lysosomes neuroimmuno neurodegen, EIC NPJPARKD, Prof, Parkinson’s GRC Chair 2023. Tweets my own.
Lance Johnson @LJohnsonLab
2K Followers 533 Following Studying brain metabolism, Alzheimer's Disease, glia & all things APOE. opinions are my own (but I feel like they are quite good)
Morven Voegeli @mor_voege
31 Followers 5K Following
eClinicalMedicine –.. @eClinicalMed
7K Followers 3K Following Gold open access clinical journal, part of @TheLancet Discovery Science, influencing clinical practice and strengthening health. IF: 15.1. #Lancet200
Nature Reviews Diseas.. @DiseasePrimers
36K Followers 259 Following Nature Reviews Disease Primers publishes Primers - introductory reviews on diseases and disorders - across all medical specialties. Check back each week!
eBioMedicine – The .. @eBioMedicine
10K Followers 2K Following Leading biomedical #openaccess journal, bridging the gap between basic and clinical research. Part of @TheLancet Discovery Science. IF=11·1 #Lancet200
STaR: Stroke, Thrombe.. @Neuro_STaR
120 Followers 108 Following A virtual course for medical students and professionals to learn the basics of stroke. E-mail [email protected] to sign up 💫
The Neurophilia Podca.. @NeurophiliaPod
2K Followers 684 Following A neurology podcast working to dispel "neurophobia" one conversation at a time. Hosted by Dr. Nupur Goel (@mdgoels) and Dr. Blake Buletko (@blakebuletko). 🧠
McColl Lab Edinburgh @EdNiBL
1K Followers 118 Following We study how the immune system influences brain health, injury and disease. Programme Lead, UK Dementia Research Institute
Ana-Lucia Garcia Guar.. @analugguarniz
804 Followers 1K Following Stroke neurologist at @MGHNeurology and @BWHNeurology via @harvardneuromds, @harvardmed | StrokeNET | @CayetanoHeredia alumni 🇵🇪 | interested in metabolomics
Maude Wagner, PhD @maude_wagner2
951 Followers 976 Following Assistant Professor in Biostatistics, @rushalzheimers | Alumni, L'Oréal-@UNESCO @4womeninscience | Executive member, @DesignDataPIA | #rstat enthusiast ⚜️
ShorterLab @ShorterLab
11K Followers 6K Following Countering deleterious phase transitions in ALS/FTD, PD, AD, and related disorders @Penn @PennMedicine @bb_upenn @BMBGGUPENN @PGGUPenn @PennNGG @CAMBUpenn
Michelle Monje🎗️ @michelle_monje
18K Followers 1K Following Neuroscientist. Neuro-oncologist. Mom. @Stanford @HHMInews @CancerNeurosci
Brent Fogel @FogelLab
315 Followers 109 Following Using genomics to study neurodegenerative diseases & neurodevelopmental disorders to improve diagnosis & treatment. Focus on cerebellar ataxia.
Aaron Boes @boeslab
8K Followers 1K Following Neurologist & Neuroscientist: Lesion Mapping | Lesion Network Mapping | Brain Stimulation
Salta Lab @LabSalta
646 Followers 239 Following Neuroscientist, Alzheimer's Disease, Adult Hippocampal Neurogenesis, Noncoding RNA
LomvardasLab @LomvardasLab
2K Followers 2K Following Laboratory of Stavros Lomvardas, PhD Zuckerman Mind Brain Behavior Institute | Jerome Greene Science Ctr https://t.co/OPR19GE561
Markus D Schirmer @schirmermd
525 Followers 192 Following Instructor @MGHNeurology/@harvardmed; Life-span neuroimage analysist; Passionate to #translate methods & #AI to the clinic and bridging the gap through #scicom
Anusha Mishra @Mishra_CBF_Lab
1K Followers 587 Following Neuroscientist. Immigrant (from the Himalayas🇳🇵to the PNW 🇺🇲). Studying neurovascular dysfunction in dementia/stroke. Lover of astrocytes ⭐ and cats 🐈⬛
Eduardo Zimmer @erzimmer
4K Followers 3K Following PI @ufrgsnoticias @zimmerneurolab | Adjunct professor @mcgillu | Research associate @cerebro_rs | Interested in glia and neurodegeneration.
Andreas Horn @andreashorn_
9K Followers 2K Following Neuroscientist @brain_circuits at @Harvardmed, @BWHNeurology, @MGHNeurosurg & @Chariteberlin into network neuromodulation. Author of @leaddbs and @stimbrains.
netstim @netstim_org
908 Followers 284 Following Neuroscience lab with focus on networks & neuromodulation. Based at @Harvardmed, @BWHNeurology, @MGHNeurosurg & @Chariteberlin. We ❤️ & develop @leaddbs
Pascoal Lab @LabPascoal
2K Followers 925 Following Lab based at University of Pittsburgh interested in diagnostic and therapeutic approaches in neurodegeneration | PI: @TharickAPascoal
jpreventionalzheimer @jpreventionalz1
2K Followers 1K Following
NeuroRestore.swiss @_NeuroRestore
1K Followers 28 Following Defitech center for Interventional Neurotherapies - We develop new strategies involving neurosurgical interventions to restore neurological functions.
ISMRM Perfusion Study.. @ISMRM_Perfusion
132 Followers 94 Following Twitter account of the @ISMRM Perfusion Study Group.
Geert Verheyden @KULneuroPT
2K Followers 3K Following Professor & Stroke Rehabilitation Research Lead @KULeuvenPT @FaBeRkuleuven @KU_Leuven 🇧🇪 Since 2024, only posting on https://t.co/WzKT0BiRfu
Israel Fernandez @israelcadenas1
162 Followers 150 Following Biologist interested in genetics and epigenetics of complex diseases. Principal investigador at IR-Sant Pau. Stroke Pharmacogenomics and genetics group
Amy Brodtmann @AmyBrodtmann
338 Followers 108 Following Disruptive voice in dementia research; mother, sister, daughter of dragons; baker, reader, yogi; world's worst runner; life-long coffee addict
Doctors Bookshelf @Doctorbookshelf
2K Followers 98 Following The Doctors Bookshelf reviews books which all doctors should read. https://t.co/hKGRfJiVrM
Christian Limberger @limberger_chris
624 Followers 849 Following PhD Student @zimmerneurolab 🇧🇷 | Brain metabolism 🧠 | Astrocytes ⭐️ | Alzheimer’s disease
Resist Alzheimer’s .. @ResistAlz
400 Followers 241 Following We study cognitive #SuperAgers & those with possible resistance to #Alzheimers due to rare genetic mutations| #APOE #Christchurch #Reelin #COLBOS🧠 @ytquiroz 🌎
Paul Jerome Lamont @PAULJLAMONT
740 Followers 3K Following Committed to solve Alzheimer's syndrome. 🇳🇿🇺🇸🇦🇺🇮🇹
Stanford Knight Initi.. @BrainResilience
678 Followers 144 Following Official account of the Phil & Penny Knight Initiative for Brain Resilience at @StanfordBrain. Pursuing a bold new science of healthy brain aging.
Robyn Klein Lab @KleinLab_WUSTL
2K Followers 121 Following Klein Lab @WUSTLmed. Studying how the neuroimmune system protects neurons from infection/inflammation. #neuroimmunology #Multiplesclerosis #glia #bbb #viruses
Daniel Reich @danielsaloreich
870 Followers 608 Following
Diana Aguiar de Sousa @Diana_A_Sousa
2K Followers 2K Following MD PhD Portuguese Neurologist Professor @ULisboa_ Co-Chair @ESOstroke Guideline Board Vice-president @SPAVC_pt #StrokeinYoung #Cerebral_Venous_Thrombosis
Jaime Grutzendler @JGrutzendler
1K Followers 199 Following Neuroscientist and Neurologist @Yale / Cellular Mechanisms of Neurodegeneration / Glial-Vascular Biology / Translational Neuroscience / Intravital Microscopy
LBDA @LBDAssoc
4K Followers 2K Following Lewy Body Dementia Association is the leading US health organization promoting education, support & research for people affected by LBD.
Parkinson's Foundatio.. @ParkinsonDotOrg
118K Followers 3K Following The Parkinson's Foundation makes life better for people with Parkinson's through expert care and research. Free Helpline: 1-800-4PD-INFO (473-4636)
Mission MSA @MissionMSA
2K Followers 865 Following Mission MSA serves the MSA community by offering support, education, research funding, advocacy and awareness.
The AFTD @AFTDHope
3K Followers 992 Following We envision a world with compassionate care, effective support, and a future free of FTD #endFTD
Sandro Da Mesquita @Da_Mesquita_S
2K Followers 755 Following Assistant Professor | Dept. of Neuroscience @MayoClinic | Role of the meningeal lymphatic system in 🧠 aging & degeneration 🤓 | Tweets = my opinions & views
Donald Gilbert @GilbertPedNeuro
1K Followers 1K Following Pediatric Neurologist, Researcher. Educator.
The Ferraiuolo Lab @FerraiuoloLab
591 Followers 305 Following Researching glia in neurodegeneration and ageing. We are based at Sheffield Institute for Translational Neuroscience (SITraN).
Alzheimer's Therapeut.. @ATRI_USC
486 Followers 136 Following We are dedicated to helping the nation and the world confront the problem of Alzheimer’s Disease.
Dr. Diego Sepulveda-F.. @diegosflab
105 Followers 85 Following Molecular Neuropathology lab at UKE, Germany | Neurodegeneration, Translational Neuropathology. Opinions expressed are Dr. Sepulveda-Falla's alone.
Rothstein Lab @Rothstein_Lab
982 Followers 429 Following Dr. Jeffrey Rothstein is a professor of neurology and neuroscience @HopkinsMedicine and is the founding director of @packardcenter. (trainee run)
Seemant Chaturvedi @ChaturvediNeuro
3K Followers 329 Following Stroke neurologist and researcher. Stewart J. Greenebaum Endowed Professor of Stroke Neurology at U Maryland. Sports enthusiast. Views are my own
Erik Musiek @ErikMusiek
2K Followers 450 Following Neurologist/scientist at Washington University in St Louis. Circadian clocks, glia, neuroinflammation, neurodegeneration. Alzheimer’s doc, soccer/track dad.
Jurgen Claassen @J_C_MD_PhD
1K Followers 891 Following Geriatrician, scientist, Radboudumc, Alzheimer,Hypertension-Brainbloodflow, Donders Institute. Author ‘Wat kun je doen aan dementie?’
Masud Husain @MasudHusain
5K Followers 1K Following Professor of Neurology & Cognitive Neuroscience @UniofOxford, Editor-in-Chief @Brain1878, Fellow @NewCollegeOx
Reduction of soluble Aβ42 or Aβ40 through solanezumab increased CSF NfL. "Binding soluble amyloid-β was associated with increased measures of neurodegeneration." Biomarker analysis of the DIAN-TU-001 study of dominantly inherited #Alzheimers @JAMANeuro jamanetwork.com/journals/jaman…
"Elisabeth Bik, expert in scientific integrity: ‘We need to slow down scientific publishing’ " | @MicrobiomDigest buff.ly/3UGvyh5
We are highlighting papers that have been published on #PredatoryPublishing. Please take a look by following the link. #ArticlesOnPredatoryPublishing @springerpub @Scopus buff.ly/3IPEUPr
Wow, a whole extra day if time is pressing .......... time passes .......... thinks .......... "No, we'll still pass, but thanks for the invite anyway"
We have taken a look at the Google Scholar profile of Kumba Digdowiseiso (following the @RetractionWatch article: buff.ly/4aTehGM). So far, in 2024, he has published (163 articles / 104 days) = 1.57 articles each day. Be interesting to see how this develops in 2024.
"We need to slow down scientific publishing," says Elisabeth Bik. english.elpais.com/science-tech/2…
This is definitive proof that you can never outgrow your mentor. Thank you Prof @ajlees for all your inspiration and guidance!
Yay! Three years after @raoult_didier @Pr_Chabriere_E and @IHU_Marseille filed a complaint against me for harassment and blackmail, the Marseille Procureur tells me today they could not find any grounds for criminal prosecution.
Parkinson's disease risk: the double whammy of lysosomal gene mutations and high exposure to pesticides nature.com/articles/s4153… @FogelLab @UCLANeurology
Landmark revisit Tissue macrophages act as cellular chaperones for vascular anastomosis downstream of VEGF-mediated endothelial tip cell induction Macrophages pull together angiogenic sprouts to fuse!😍 @Joey_JMVieira @RuhrbergLab @BloodJournal 2010 ashpublications.org/blood/article/…
Q97: Which antihypertensive drugs have the best effect on white matter hyperintensities (WMH)? A: Angiotensin-converting enzyme inhibitors are 'most consistently associated with less WMH progression” bit.ly/3Y8HOFE Citing checklist: bit.ly/3SD8VHC
New #GraphicMedicine by Dr. Mom Grace Farris—"QI Parenting” ow.ly/uLb450Rp8yv
Cell cycle genes are re-activated in some #neurons as our brains age. @chow_heiman &co use bioinformatics to characterize the prevalence, nature & fate of these #CellCycle re-entry neurons, within the healthy #aging & diseased human brain. #PLOSBiology plos.io/4dbHoXt
Researchers revealed that diosgenin significantly improved #cardiac function in a myocardial infarction 💓 mouse model, reducing cardiac fibrosis and cell apoptosis while promoting #angiogenesis. 📖 @BBRCME | bit.ly/49QFsRz
#SARSCoV2 inside the synapse... Brain explants from individuals with or without COVID-19 were analyzed (high-throughput proteomic screens) and identified increase in the expression of three synaptic proteins — Bassoon; presynaptic fibronectin leucine-rich transmembrane-3 protein…
How #SARSCoV2 can disrupt brain synapses nature.com/articles/s4156… nature.com/articles/s4156… Increased expression of 3 synaptic proteins, and finding a drug that restores synaptic function @NatureMicrobiol
We found this article interesting and this is just one small quote. You can see the full article by following the link. #FJNSoundBite @ElsevierConnect @ELS_Dermatology buff.ly/3wxgXp7
Brain neurons re-entering the #cellCycle age quickly and shift to senescence, particularly in neurodegenerative disease @PLOS @PLOSBiology medicalxpress.com/news/2024-04-b…
A huge congratulations to Dr. Gan for receiving the 2024 Jessica M. and Natan Bibliowicz Award for Excellence in Mentoring Women Faculty! It is a pleasure to receive your guidance daily in our lab. @WeillCornell #WCMDiversityWeek diversity.weill.cornell.edu/about-us/diver…
The sign outside my office used to read: 'Ardem Patapoutian, PhD, Professor.' My title keeps changing... I have no idea who's behind it, but I kind of like it!
Trends for United States
You might like
