Angela Bitting @AngelaBitting
Joined September 2011-
Tweets55
-
Followers48
-
Following275
-
Likes574
👀 Anyone see the google doodle today. 😍😍😍
Today feels like a good day to share some DNA haikus… 🌾 Twist, snip, paste, repeat, DNA’s our crafty cheat— Who needs Mendel’s wheat?
⚡️DNA up to 5 kb! Just a reminder that you can get Twist Express Genes, sequence perfect Clonal Genes shipped in as few as 5 days,* in the vector of your choice. Get your genes here: twistbioscience.com/products/genes… Or gene fragments shipped in as few as 2 days: twistbioscience.com/products/genes…
🚇 Spotted in Boston: our ads, now live on the subway, making rush hour slightly less painful! 🧬 WE love science, we love scientists 🧬 You've seen us on the subway, now see what we're all about: bit.ly/4h5kGCC
🚐 Beep, beep! @TwistBioscience is bringing science on the road to you! We will be criss-crossing the nation, rolling up in our Twist Sprinter Van to share some food, world famous #TwistSwag, prizes, and to hear about the science that you’re passionate about…
Really great to be able to give back to the community, serving with my amazing colleagues
🫶 Twist SSF & Alameda County Community Food Bank teamed up to bring over 21,000 meals to local residents in need. Twisters helped sort and pack fresh produce in support of @ACCFB’s mission to eradicate hunger and provide nutritious food to those in need across Alameda County.
🥇🥈🥉The Olympics as things seen in science… First up: Sailing as the PI and et. al.
AATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAGAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAAAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTGA
Back by popular demand for 2024: The #Oscars as things seen in science. First up, Sam Rockwell as a failed PCR
So proud of @TwistBioscience @EmilyLeproust ! Fabulous night with so many special touches @CALifeSciences
About last night… Huge congratulations to our CEO and co-founder @EmilyLeproust for winning @CaLifeSciences’ 2023 Pantheon Award for Leadership. We couldn’t agree more! 🧬
#VMAs as things seen around the lab… First up: Justina Valentine as slime mold
It’s here! Our 2023 ESG report is now live. Find out how our miniaturized platform for writing DNA is different than traditional 96-well plate approaches in terms of carbon emissions- we've quantified it…investors.twistbioscience.com/news-releases/…
@Aeroplan @petequily It would be great if anyone every answered the phone. Calling the number they disconnect me due to high call volume. No option to hold, for callback. #worstcustomerservice EVER
@Aeroplan I cannot reach a live person to help me delete my points for a trip that should have been credited to MileagePlus. I've spent more than 4 hours on hold and just get disconnected. Please help.
That's what I keep thinking about when I'm reading the headlines. Granted its bad, not taking anything away. And...
San Francisco didn’t have fresh air for 45 days in 2020. Can you imagine how big of a news story this would have been if it happened in New York? We’d still be talking about it
@dp_regan @CSRisks @TwistBioscience @jdiggans Thanks so much for coming to @TwistBioscience @dp_regan - really enjoyed having you.
I’m really proud to work at a company that is committed to not only implementing, but consistently advancing ESG practices. Shout out to @TwistBioscience for taking the next step by joining the @globalcompact! Read more on the #TwistBlog… twistbioscience.com/blog/company-n…
The covid pandemic has made a great case for viral discovery and monitoring. @TwistBioscience understands the importance of virus management and has developed #NGS and synthetic control tools to support researchers. Great read about them here… asianscientist.com/2023/01/sponso…
What a year!
This Year’s Top Moments In #Biotech! 2022’s most exciting advances involving #syntheticbiology and how they forecast a rising tide of scientific progress in 2023. #synbio #TwistBlog twistbioscience.com/blog/science/2…
ShortIdeasLab🇺🇸 @Udohooh0318301
49 Followers 2K Following 15-30% Monthly | 2 High-Conviction Stocks.Short-Term Gains: 15-20% in Days/Weeks.DM "JOIN" for WhatsApp Alerts. Live Trade Signals • Market Analysis
Retutaski @retutaski80224
36 Followers 1K Following
Mo_vie @Movie895036
7 Followers 183 Following
iGEM MAKERERE 2023 @2023igem
243 Followers 829 Following We are SILVER-MEDAL winners @iGEM, and designing a #BIOSENSOR to ease the Detection of Toxic Poly Aromatic Hydrocarbons within the #environment.
Tina Han @tingfordha
1K Followers 4K Following Genomics scientist by day, amateur potter and yogi by night, who loves culture and nature. @MPI_MolGen Tweets are my own; RT ≠ endorsements. instagram/wawapot
Oregon Life Sciences @OregonBio
899 Followers 608 Following
Kit Fuhrman @ScienceKit
99 Followers 525 Following Immunologist that likes to code and all things techie
genomicmedia @genomicmedia
89 Followers 319 Following Genomic Media: SSHRC IG funded project led by @mel_hogan (PI) + @bestqualitycrab (co-PI) + an amazing teams of archivists, artists, scientists, scholars, etc.
Karin Strauss @KStraussIdeas
748 Followers 135 Following Researcher @MSFTResearch. Focused on DNA storage and emerging memory technologies.
Amanda Houlihan @ahoulihan15
92 Followers 126 Following Communications at @TwistBioscience | Sometimes rowing coach | Tweets are my own | She/her
Fayek Racha @FayekRacha
1K Followers 4K Following #PhD in #Biology : interested in #Science #Communication #Pharmaceuticals #Innovation #Technology #Genetics, working @agilent
Elizabeth S. Eaton @LaboratoryLiz
320 Followers 205 Following Health and science reporter looking for next opportunity; Former @BioCentury writer
Meg Anderson Brooks @MegLAnderson
426 Followers 1K Following Science nerd, Policy ghost writer, Explorer of rabbit holes, Jazzercise fitness instructor, Wife, Mom
Dr Donna Walker @DrDonnaWalker1
8 Followers 204 Following
I Despise POTUS 45! @despisePOTUS45
2K Followers 4K Following
Jamie Schwarzbach @JLSchwarzbach
309 Followers 817 Following Chemist turned marketer that dabbles in cycling, snowboarding, and traveling. Currently @nateraoncology, previously @twistbioscience. Opinions my own.
Brick Lane Prod @BrickLaneProd
51 Followers 399 Following Société de production de documentaires. Science, Technologies, Investigation
Dale Yuzuki @DaleYuzuki
6K Followers 6K Following Independent advisor to life science tools companies. Author of First Light (https://t.co/FdxFMKFuCs). Genomics · Proteomics · Diagnostics · AI Biology
Luis Ceze @luisceze
4K Followers 2K Following computer systems architect. marveled by biology. VP @ NVIDIA, professor @uwcse. prev ceo @OctoAICloud & venture partner @madronaventures.
Sheryl Seapy @sseapy
190 Followers 666 Following Healthcare PR/corporate communications @RealChemistry_💊🩺; USC Trojans and college football fan 🏈; multi-tasker extraordinaire!
Michael Fitzhugh @mfitz
3K Followers 3K Following VP, Chief of Media Strategy @LifeSciComms. He/him. Formerly: @BioWorld, @ucbsoj alumn. 我学习汉语.
Jennie (Walters) Myhr... @Jennie_Walters
96 Followers 207 Following Full stack software engineer with background in biotech journalism. Excited by people pushing boundaries in medicine and tech.
Allen School @uwcse
11K Followers 3K Following The Paul G. Allen School of Computer Science & Engineering educates tomorrow's innovators while developing solutions to humanity's greatest challenges.
Anu Hoey @anuhoey
36 Followers 595 Following
Health+Commerce @health_commerce
549 Followers 1K Following #PublicRelations & #DigitalMarketing agency dedicated to helping #healthcare companies achieve their goals. #Medtech #Biotech #DigitalHealth #HealthTech #HCSM
Kwame Boateng @KwameBo41028836
237 Followers 528 Following
Joseph Garamella @JoeGaramella
16 Followers 177 Following
Ellen Rose @EllenRoseA2Z
283 Followers 604 Following
KQED Science @KQEDscience
26K Followers 20K Following Award-winning science and environment coverage from KQED. 📬 Sign up for our weekly newsletter: https://t.co/A4wXMEHjsl. ▶️ Find us on Instagram: @KQEDScience.
Fertility Funds @wefundfertility
898 Followers 1K Following Empower yourself. Fertility Funds is here to offer our support.
resolveorg @resolveorg
16K Followers 12K Following RESOLVE: The National Infertility and Family Building Association improves the lives of women and men living with infertility.
Illumina @illumina
96K Followers 8K Following Dedicated to advancing human health by unlocking the power of the #genome. 🧬
Mike Adams @MikeAdamsAFC
1K Followers 856 Following President of Adams Financial Concepts, LLC. Focus on clients doing better than markets. Radio Host of About Money KLFE 1590am. Follow for industry insights.
Katie Lownes @bittika
12 Followers 46 Following
Greg Schafer @gregwschafer
4 Followers 26 Following
Adrian Cukar @AcukarCukar
25 Followers 29 Following
Glen Sato @GYSfromLA
75 Followers 726 Following
Kerri Hunter @takeahikehunter
8 Followers 51 Following
Denise Powell @DeniseTPowell
118 Followers 198 Following Full time Life Sciences communications professional. Part time skier/biker. My infrequent tweets are definitely my own!
Media + Health @ps_health
2K Followers 2K Following We connect our followers: doctors, wellness experts, & healthcare organizations, with members of the media looking to talk to sources for their articles.
Deej on Science @DeejOnScience
117 Followers 454 Following Scientific News, Knowledge and Experiments from Deej. DFTBA - Hit that follow button :) & visit http://t.co/FZYh14WSmb http://t.co/bp7qbhI1zq
Jen McMahon @tmcmahon04
7 Followers 67 Following
Kelli Kampanis @perkidiablo
229 Followers 377 Following
NSCEB @biotech_gov
570 Followers 10 Following Advising the U.S. Government on policy at the intersection of biotechnology + national security.
Congresswoman Andrea ... @RepSalinas
5K Followers 331 Following Working for #OR06. Proud Latina, mom, & first-generation American. Member @HouseAgDems & @ScienceDems. Leader in @HispanicCaucus & @NewDemCoalition.
Emily Mullin @emilylmullin
15K Followers 1K Following Staff writer @WIRED on the biotech beat [email protected] or emullin.06 on Signal
Melodie Ha @melodieha
2K Followers 681 Following I like to tweet about China + tech. Views = my own, etc.
Landon H. @Landonheid
586 Followers 413 Following Tech policy + China on the Hill. Fmr FSO @StateDept - Embassy Beijing, INR, China House. Views my own.
WmC-Tom Bitting @tbit35wc
28 Followers 233 Following Even more than WHAT you think, HOW you think MATTERS. Atul Gawande. (Jun 10, 2016) Rosen:twtr new NEWS system. favs @anneapplebaum @NormOrnstein @jayrosen_nyu
Taylor Swift @taylorswift13
81.1M Followers 0 Following Original song "I Knew It, I Knew You," for Toy Story 5, out now! ☁️
Goose Data (wa/wa) @GooseData
6K Followers 215 Following Biotech visionary. Looking for best drugs with goose data. Retweets mean honking endorsement.
California Life Scien... @CALifeSciences
12K Followers 6K Following California Life Sciences is the state’s most impactful life sciences membership org. advocating for the industry & its diverse innovation pipeline
🐢🐢🐢John Gree... @johngreen
4.0M Followers 763 Following Vlogbrother, TB hater, AFC Wimbledon supporter. Wrote Anthropocene Reviewed & Turtles All the Way Down (out now on Max). Biz Q's: [email protected]
ARK Invest @ARKInvest
816K Followers 932 Following Investment advisor focused solely on disruptive innovation. Disclosure: https://t.co/7lwRaEv61H
Kelsey Piper @KelseyTuoc
65K Followers 1K Following We're not doomed, we just have a big to-do list.
Massimo @Rainmaker1973
4.3M Followers 171 Following Engineer. Selecting and curating pictures and videos trying to awaken your sense of wonder since 2014. Science, tech, art, weather, space, the unusual around us
Peter Kolchinsky @PeterKolchinsky
64K Followers 184 Following Managing Partner, RA Capital Management. We build & invest in biotech companies. Scientist. Author, The Great American Drug Deal. https://t.co/ARVLrrTQU4
Oregon Life Sciences @OregonBio
899 Followers 608 Following
UCLA Parents @UCLA_Parents
1K Followers 158 Following Hey UCLA parents and families: follow us to stay in the know about UCLA! Send us your questions through Direct Messages.
Karin Strauss @KStraussIdeas
748 Followers 135 Following Researcher @MSFTResearch. Focused on DNA storage and emerging memory technologies.
Charles Roberts @CCRobertsARK
59K Followers 3K Following Chief Investment Strategist, Private Equity @ARKInvest; techbio cofounder: AI/omics unicorn Freenome, Relation Tx. Disclosure: https://t.co/EueoFlXwoI
Kate Kelly @katekelly
54K Followers 1K Following New York Times correspondent covering power, money, and influence. Retweets don't mean I agree.
Drug Discovery World @DDWJournal
3K Followers 2K Following The Global Business Review of Drug Discovery and Development
DNA Script @DNAScript
2K Followers 1K Following Transforming how molecular biology translates to human health, personalized medicine and synthetic biology
Rewire News Group @RewireNewsGroup
71K Followers 4K Following Expert repro journalism that inspires. Home of @AngryBlackLady Chronicles, @Hegemommy, #BoomLawyered and The Fallout 📧
Ibis Reproductive Hea... @IbisRH
7K Followers 1K Following Global research and advocacy org advancing sexual and reproductive autonomy, choices, and health worldwide. #IbisDrivesChange
Free the Pill @freethepill
5K Followers 3K Following Campaign of @IbisRH working w/ our partners to educate & engage in support of over-the-counter birth control pills in the US. Join the movement to #FreeThePill.
DNA Data Storage Alli... @DnaDataStorage
801 Followers 41 Following An alliance of leading storage and biotech companies to drive the market of DNA Data Storage. A @SNIA Technology Affiliate.
Life Science Cares @LS_Cares
3K Followers 797 Following Uniting the life science community in the fight against poverty. Learn more at https://t.co/GXf6TCKS46.
Christopher Voigt @Geneticdesigner
11K Followers 825 Following Composing DNA / Professor and Department Head @ MIT Biological Engineering
Alexandria Ocasio-Cor... @AOC
12.7M Followers 4K Following US Congresswoman, NY-14. In a modern, moral, and wealthy society, no American should be too poor to live. People-Funded, takes no lobbyist💰. Personal account.
County of San Mateo @sanmateoco
20K Followers 631 Following News, events & info from the County of San Mateo, protecting & enhancing the community's health, safety, welfare & natural resources.
San Mateo County Heal... @SMCHealth
7K Followers 610 Following The health department of the County of San Mateo. This account is monitored during business hours M-F 9am-5pm.
Takeda @TakedaPharma
29K Followers 257 Following Official Twitter handle of Takeda Pharmaceutical | Better Health, Brighter Future. Read more: https://t.co/vS94jm6SBf
James Crowe @croweje
474 Followers 19 Following
Iliza Shlesinger @iliza
223K Followers 425 Following I created the term “Elder Millennial” and I am one! text me for touring info 323-370-4480
BioMADE @TheBioMADE
2K Followers 2K Following BioMADE is securing America’s future through biomanufacturing innovation, education, and collaboration. Proud member of @MFGUSA
Kai Kupferschmidt @kakape
133K Followers 2K Following @kakape.bsky.social science journalist. molecular biologist. curious. writer at @sciencemagazine part of @pandemiapodcast, all things #blue
City of Pleasanton @pleasantonca
7K Followers 354 Following Connecting you in more meaningful ways with photos, events and media announcements. View our social media policy: https://t.co/rOwzUBM4rS #Pleasanton
CAL FIRE SCU @calfireSCU
51K Followers 933 Following Proudly serving Santa Clara, Alameda, Contra Costa, western Stanislaus and San Joaquin counties.
Apoorva Mandavilli @apoorva_nyc
50K Followers 1K Following Reporter @nytimes on global health & infectious diseases; [email protected] Before: Founding EIC @Spectrum, cofounder @CultureDish
East Bay Regional Par... @RegionalParksPD
5K Followers 819 Following Call 911 for emergencies. Police services for the East Bay Regional Park District. This account is not monitored 24/7. 510-881-1833
Roxanne Khamsi @rkhamsi
20K Followers 2K Following contributing writer @TheAtlantic - author of BEYOND INHERITANCE, available now: https://t.co/NewbIzKUXi Free alerts: https://t.co/tJqvj4vDXo
Telesis Bio @Telesis_bio
3K Followers 3K Following Telesis Bio empowers researchers with the tools they need to rapidly and securely design, code, and create synthetic DNA and mRNA.
Nicholas Florko @NicholasFlorko
7K Followers 2K Following Staff writer at The Atlantic reporting on why Americans are so unhealthy, and what's being done about it. Lover of public records and @terrorhardcore.
Trevor Bedford @trvrb
402K Followers 748 Following Scientist @fredhutch, studying viruses, evolution and immunity. Collection of #COVID19 threads here: https://t.co/Yc4fun5rcp
Caitlin Rivers @cmyeaton
172K Followers 371 Following Director of Center for Outbreak Response Innovation @JohnsHopkinsSPH. Author of Crisis Averted. Founder of Force of Infection.Trends for United States
You might like
