Scorsese @Scorvalue
Tuitero infravalorado Harrison, AR Joined April 2023-
Tweets9K
-
Followers788
-
Following565
-
Likes113K
Si es que lo van pidiendo macho
🇪🇸 Sonia Bermúdez lanza, en @tjcope , el reto sobre un partido entre la selección masculina y femenina 🤔 "No sé cómo quedaríamos" cope.es/programas/tiem…
@MurcianoJapo Siempre es un municipal acomplejado
Lleva 1 mes duchándose con las gafas de sol puestas, jamás te lo perdonaré Justin
🇪🇸🎉 Ilia Topuria celebrating Spain’s World Cup win Great to see El Matador in good spirits 👏
@humillamendigos Al corroborar que efectivamente no han evolucionado, Don Rodrigo decidió marcharse
Al retrasado este le van a pintar la cara en todos y cada uno de los estadios de la Premier jajajajaja
Estos se creen que debemos adoptar sus costumbres, que se resumen en: - Liarla por la calle - Aumentar las estadísticas de violencia doméstica - Pasar hambre - Evitar al máximo la ducha
“Gora ETA alhamdulillah”
Sociedad enferma, a estos habría que catapultarlos
Recordad que en estos momentos hay lugares en España donde hay españoles con miedo de celebrar este Mundial. Hoy, celebremos. Mañana, luchemos contra eso.
Disgusting behaviour by the Argentinians at the end, especially Paredes. Just a bunch of nasty violent thugs, and a disgrace to football. Never been so happy to see a team lose.
Terribles declaraciones de Otamendi tras la derrota
Labrador @Labradordelalja
6 Followers 21 Following
Jose Luis Juzgado @JLJLucas
12 Followers 699 Following
meritocrasia🕊️�... @pato_lqc
830 Followers 2K Following pasajero del Samsara | Daisy Edgar-Jones fan account | Latinsimia hater | Footjob enjoyer
@Gott Mit Uns @GottMitUns1907
384 Followers 307 Following Español, sevillano (del Tiro De Línea) . Æ Políticamente incorrecto
AdolfoSánchez💬 @liladolf99
179 Followers 3K Following Ansío vivir como si fuese el último día. 🇪🇦PLVS VLTRA🇪🇦
Óscar Rodríguez �... @pepitobondia76
1K Followers 4K Following Dios,Patria y familia. VALENCIA CF 🇪🇸✋ Provida 👣 AHTR Anti-Agenda 2030
Sanchez @SanchezCarry
3K Followers 235 Following Ingeniero Informático. Investigaba movidas de sistemas distribuidos.
loretta @loretta76520308
10K Followers 10K Following Almirante a priori y a posteriori. Melasudista postfarsèmico. Medicorreasignadordesexofóbico. Al que no le guste, que no mire!
ÁlvaroGR @lvaroGR5
18 Followers 159 Following Intento de powerlifter Nacionalista El racismo y los prejuicios te salvarán la vida
ANTZRDS @Adrin1141290
1K Followers 5K Following SkankHunt42,Facha,malo malísimo. Hala Madrid y VIVA VOX💚💚💚🇪🇸 De Mou a morir 💪🏻💪🏻💪🏻
KYRE KING 🦇 @erikito_15
711 Followers 2K Following TOP 44 artista más escuchado en 🇦🇷 octubre 2020. +4.000 oyentes mensuales en Spotify. 👉: https://t.co/0BA7avQ3tC
Meri Calvet @mericalvet27
2 Followers 61 Following
☁︎ maddie ♡ blo... @maddiebby34059
6 Followers 817 Following hi im maddie 💌 not clingy just affectionate 🍬💕 mutuals please
David Martínez Valls @martinezvaalls
6 Followers 1K Following
Zalo @Zalo14_
3 Followers 50 Following
Sergio Sergius @SergioSergius81
327 Followers 3K Following
bgood @ferbgood
110 Followers 1K Following Palabras que gastar. Sobre golf, ciberseguridad, comida&bebida e inversiones. Lo que me gusta.
Kike @kikemarchan
3K Followers 513 Following Soy de Ciudad Real y ahora vivo en Filipinas. Antes en Madrid, Seúl, Kuala Lumpur o Ho Chi Minh City.
Divine @makejpaingreat
105 Followers 902 Following
Strelok 30 🇪🇸�... @Alfredo82738104
430 Followers 1K Following Madridista, ciclista, economía e ingeniería. Amante del noble arte del boxeo y con Don Benito (Badajoz) y Madrid capital siempre en el corazón.
𝔯𝔞𝔫𝔞 𝔦... @rana_iberica
19 Followers 199 Following
Ludwig @Vanbezoven
0 Followers 3K Following
Le Flaneur de Fort Pi... @LeFlaneurdeFP
234 Followers 1K Following Soy liberal porque el socialismo me hizo así.
Celula Cedista @celulacecedista
228 Followers 431 Following ATGGAATAACTTCTTGCTATGCAATAAGCTAATACTCAAAATATTCAATAAGATGAATAACCTGCTCTTATGGCTTAAGAAAATTGTGCTAATACTGCTGATCAATAACGTGAAGCTGATTAAATTAATTAATCTCCTGCTAATATTTCTCAT
Angelo Mota @AngeloMota80037
4 Followers 402 Following
Cristian Dedeu VDB @CristianDedeu
240 Followers 422 Following
Kanouté de las nieve... @Naldo_Gonsales
188 Followers 242 Following Planto maíz pal melandru. 1993. Enfermero Especialisto EFyC. Piloña, Asturies.
Anita Pastor Respect ... @MurcianoJapo
24K Followers 997 Following Lo que sea que hice, lo hice por los loles
Yesid Jr. Peña Mendo... @yesidjunior06
145 Followers 3K Following Imposible se encuentra solo en el diccionario de los tontos. El sabio crea las oportunidades y hace que todo sea posible. - Napoleón Bonaparte -
Edward Snowden @Siesta8801
6 Followers 477 Following
Jose A. @murcity_a
322 Followers 7K Following
(NUEVA CUENTA) Javier... @JavierFdz54
93 Followers 1K Following Lector que a veces escribe. Católico, padre y eterno aprendiz de caballero andante.✝️🇪🇦 Nueva cuenta, la anterior me la piratearon.
M. @Jruns_
3 Followers 215 Following
cryptobiker @david63889982
43 Followers 659 Following
Manfred @getmanfred
13K Followers 532 Following La plataforma para que gestiones e impulses tu carrera. Te acompañamos a lo largo de tu camino. Si buscas contratar el mejor talento, podemos ayudarte también
Ahorraconmarta @ahorraconmarta
9K Followers 121 Following Política, actualidad y un toque de humor. 🃏🎙️
Carlos Domingo @carlosdomingo
46K Followers 7K Following Founder and CEO https://t.co/16sVCzCO1L. Managing director https://t.co/k0zKRqpLmF. Startup investor. Author.
Genie @Genie_93
467 Followers 418 Following PS5 Platinum Trophy Hunter I post all things gaming including guides, how to's & tutorials
Soulless Analyst @SoullessAnalyst
30K Followers 614 Following formerly infra/renewables PE. now private credit. retired
PrivateEquityGuy (Mik... @PrivatEquityGuy
58K Followers 485 Following Host of Buyers & Builders podcast | Investing in profitable businesses. Tweets about the process.
Broadcom @Broadcom
66K Followers 3K Following Broadcom provides semiconductors and infrastructure software for global organizations’ complex, mission-critical needs.
Marco - MMA @Marco_mmabjj
1K Followers 549 Following Lifestyle: MMA gym in London -partner . bjj competitor brown, world medalist , Athlete. MMA, thirst 4 knowledg , Work: commodities trading, structured, ficc
Zane Hengsperger @zanehengsperger
40K Followers 2K Following @noxmetals is a relentless mission to reindustrialize america | large proponent of technologically abundant industrial capacity in the west | yc s25
Régulo @ReguloRegulin
1K Followers 666 Following De Pamplona a NY | Real Estate Capital Advisor | Filtro, Analizo y Estructuro Inversiones Inmobiliarias para un Capital que Busca Rigor, no Ruido.
Marc Clemente @MarcCley
722 Followers 255 Following Venture Capitalist @Kfundvc | Former-drummer-turned-investor
Demis Hassabis @demishassabis
1.5M Followers 176 Following Nobel Laureate. Co-Founder & CEO @GoogleDeepMind - working on AGI. Solving disease @IsomorphicLabs. Trying to understand the fundamental nature of reality.
Isomorphic Labs @IsomorphicLabs
59K Followers 82 Following Solve all disease. Developing and applying frontier AI to unlock deeper scientific insights, faster breakthroughs, and life-changing medicines.
Joselu Zarco @ZarcoJL
2K Followers 921 Following Una forma, tan válida como cualquier otra, de hablar solo.
WAKASO DE MARICHALAR ... @VS4_MOSSADEADO
21K Followers 92 Following SANTA MARE DE DÉU VERGE DE MONTSERRAT PATRONA DE LA NOSTRA PÀTRIA CATALUNYA PREGA PER NOSALTRES
Jacques O @Dr_Destouches
3K Followers 2K Following Not a likeable fellow. Won't follow back. Your Bordeaux specialist. WTA 3. Eno-blog: https://t.co/d45ApH19fd
ChudTheBuilder @ChudTheBuilder
231K Followers 57 Following Free Speech Patriot ☦️Christ is King. 🇺🇸America First. Live IRL On PumpFun @ChudTheBuilder
javi santana @javisantana
16K Followers 837 Following Co-founder of @Tinybird - I do high performance data processing at scale
Steve Inman @SteveInmanClips
645K Followers 444 Following That MMA/Sports commentator who narrates random videos from around the globe. Official page of Steve Inman
Intern Pierre @internpierre
6K Followers 727 Following Luxury & markets analysis without the PR gloss. On-the-ground channel checks from Monaco to Madison Ave. Coverage includes LVMH, Ferrari, RH, Hermès, Cucinelli
Manny Riviera @rivierachico
56 Followers 326 Following Tu Manny Riviera, yo Manny Pacquiao. Cultura del pelotazo enjoyer
Alfonso C. Suárez @AlfonsoCSuarez
6K Followers 1K Following Periodista gastronómico en Madrid. 📍 Te enseño trucos de cocina que funcionan y dónde comer de verdad. 🤤 Recetas caseras, producto y cero tonterías. 🥘🍷
Brent Underwood @underwoodbrent
37K Followers 37 Following Living in an abandoned ghost town, trying to bring it back to life. Videos at "Ghost Town Living": https://t.co/ySqTKZ0TuI
𝔏𝔢𝔩 polític... @ReinaCabreada
9K Followers 769 Following Brigada político-social Trabajo en ONU. Periodista de @El_Pais y Comisión de DDHH de Europarlamento. Escuadrista. Autora de 172 libros. Principal: @EnLosLuceros
Cole Jaczko @colejaczko
26K Followers 1K Following I make people confident & with magnetic energy so they can fulfill their potential. BE THE GUY.
Jason R. Williams, MD... @jasonwilliamsmd
29K Followers 471 Following Interventional oncologist. Board-certified radiologist. Immunotherapy. Longevity. Director, @WmsCInstitute | Author of "The Immunotherapy Revolution."
PlayStation Nostalgia @PlayStalgiaX
198K Followers 1K Following Retro PlayStation Content | Co-host of the Retro PlayStation Podcast https://t.co/tdsG5slYdW | Subscribe to the YouTube 👇
Pep Martorell @pepmartorell
14K Followers 1K Following DeepTech & Science. Partner at @InvivoPartners. Teaching fellow at @esade. Former Associate Director at @bsc_cns
Jason Kelly @jrkelly
33K Followers 3K Following Co-founder and CEO at Ginkgo Bioworks ($DNA)🧬 Former Chair of US National Security Commission on Emerging Biotechnology 🇺🇸
Alberto Pugilato @Albertopugilat
86K Followers 872 Following Patriota y cantante de Pugilato. Padre de 3 hijos. Activista NS perseguido y censurado. Anti-Agenda 2030. VENCEREMOS
Álvaro Bernal 🥑 @abn
5K Followers 644 Following Just a coffee lover who designs apps. Co-founder @clima_studio. University Design Teacher @u_tad. I’ve designed products for 100+ startups and big companies.
Jesse Morse, M.D. @DrJesseMorse
189K Followers 2K Following Health Optimization utilizing Peptides & Stem Cells. Board-certified: Sports & Family medicine. @stackapp. Sports Injuries for @InjuryExpertz.
• @yipikayei7
48K Followers 1K Following
DAN KOE @thedankoe
959K Followers 965 Following join the next content bootcamp: https://t.co/KHN63fQmtI




































