Chris Edwards🐭 @ChrisEd16512812
Christian. Bonhoeffer: Silence in the face of evil is itself evil: God will not hold us guiltless. Not to speak is to speak. Not to act is to act. crosswalk.com/faith/spiritua… orkney Joined January 2022-
Tweets17K
-
Followers1K
-
Following885
-
Likes5K
Just received an invitation to an important USP two-day online Workshop on Endotoxin Measurement. It is free! geoffpain.substack.com/p/how-did-i-ge… @Kevin_McKernan @JesslovesMJK @CanningPharm @karrichapus @JanJekielek @MarinatZhang @MaryanneDemasi @SuziHoutz @Shirl3yBell @tatiann69922625
@Jikkyleaks @PaulaJardine @ChrisEd16512812 @itsthemnotus Lipid nanoparticles: The game-changer in CRISPR-Cas9 genome editing pubmed.ncbi.nlm.nih.gov/38288017/
Novak Djokovic awarded World Sportsman of the year. His refusal to take the Covid vaccine cost him millions of dollars. He is a hero not only in tennis but for standing up for his rights.
@DrJBhattacharya Have you seen this? This student declaration pays homage to you, @MartinKulldorff & @SunetraGupta for the GBD launched on the same day (3 years later!): studentdeclaration2023.org Please help us build momentum & HALT college mandates! Yes, still happening at almost 80 US colleges!
@DrJBhattacharya Have you seen this? This student declaration pays homage to you, @MartinKulldorff & @SunetraGupta for the GBD launched on the same day (3 years later!): studentdeclaration2023.org Please help us build momentum & HALT college mandates! Yes, still happening at almost 80 US colleges!
@ChrisEd16512812 @itsthemnotus @mRNAdeaths @PaulaJardine That is why they are in a patent battle.
@mRNAdeaths People need to understand the significance of #taggate. The 3 GMO "codon optimised" vaccines (Pfizer, Moderna and Novavax) do not have random codon optimisations. They converged at one specific sequence, that just happens to make you #CRISPRready. x.com/jikkyleaks/sta…
@mRNAdeaths People need to understand the significance of #taggate. The 3 GMO "codon optimised" vaccines (Pfizer, Moderna and Novavax) do not have random codon optimisations. They converged at one specific sequence, that just happens to make you #CRISPRready. x.com/jikkyleaks/sta…
@TheFigen_ That's called a great team work! 👏
🛑 Treason. Please read this excellent article by my friend @JohnStone32
🛑 Treason. Please read this excellent article by my friend @JohnStone32
BREAKING - New study shows that women injected with COVID-19 mRNA vaccines experience a 34% lower pregnancy rate when undergoing IVF treatment compared to unvaccinated/uninfected women. The study also found that unvaccinated/uninfected men had more than twice the sperm…
🌍 South Africa becomes the first African country to debate the WHO’s I.H.R 2005 amendments and proposed new pandemic treaty in Parliament 📍WHO's monopoly over health is a national elections issue for every country. Proper public participation, parliamentary oversight and an…
Most famous for her personal triumph over the limitations of both blindness and deafness, Helen Keller was one of the twentieth century's leading advocates for individuals with disabilities.
@eekymom You’re most welcome 😘. Their Internet clean-up operations are not scrupulous enough & there are breadcrumbs of evidence left everywhere.. For the record, the study demonstrates that the vaccines had no discernible effect on transmission…unsurprisingly. thelancet.com/journals/lanin…
A (fairly rare) example of great PR/communication. Clear update explaining what happened, how it happened, and why everyone needs to move along, please.
A (fairly rare) example of great PR/communication. Clear update explaining what happened, how it happened, and why everyone needs to move along, please.
Genius.
This performance is strong, but I’ll never forget how Andrew Neil lost his moral compass during Covid.
This performance is strong, but I’ll never forget how Andrew Neil lost his moral compass during Covid. https://t.co/iqctCeyDJF
Dr Clare Craig @ClareCraigPath
243K Followers 996 Following Co-Chair HART group. Diagnostic pathologist, lover of data, digital pathology and AI, sceptical but optimistic. Views my own not the RCPath's.Alex Mitchell @ake2306
34K Followers 16K Following VITT (VACCINE INDUCED THROMBOTIC THROMBOCYTOPENIA). There are 445 VITT's and tragically 81 fatal cases. https://t.co/6TIq6Fe5l9Dr David Cartland @CartlandDavid
219K Followers 10K Following BMedSci Published scientist MBChB MRCGP promoter of safe evidence based medicine, good medical ethics. Father ✝️🦁❤️Pronouns: told/you/so!! https://t.co/C4uZAiVvsbJikkyleaks 🐭 @Jikkyleaks
96K Followers 3K Following Home for @jikkykjj the whistleblowing lab mouse #Modernagate #CTCCTCGGCGGGCACGTAG #3Tablets Pronouns: mouse/mouseself Tweets are public interest disclosuresProf Norman Fenton @profnfenton
81K Followers 495 Following Making sense of math, probability & risk. Bayesian. Causal knowledge + data https://t.co/ha2Pu8ddR5 https://t.co/sTrkeY8CM9Adam Rowland MSc @oneadds
26K Followers 3K Following Physio/S & C Trainer- 16yrs Pro sport; Ballet ,Rugby, Military, PGA tour, severely injured due to AZ 💉 vaccineChris 🐭 @chrislittlewoo8
45K Followers 15K Following Truth, Justice, Honour & Integrity are keystone principals to live life. it’s a disgrace that our current elected representatives have no idea of their meaning.Charlotte, The Barone.. @CharlotteEmmaUK
81K Followers 22K Following 🇬🇧UK Producer @ TNT ~ Today’s News Talk ✨@tntradiolive ✨Receipt Keeper ✨Connector of Voices ✨ Former NPC ✨Commentator✨Awake not Woke ✨Loyal to the Foil✨jules serkin @julesserkin
20K Followers 10K Following #Radio presenter @scoffquaff Xmas special show #BBC #PR #health #hospitality Listen: https://t.co/3DXO3weePdJikky the mouse 🐭 @TheJikky
26K Followers 790 Following Fan account for fallen mice #jikkyleaks #openvaet #freejikky #CTCCTCGGCGGGCACGTAG In hibernation - see @jikkyleaks Pronouns: mouse/mouseselfHicksy @hicksyalex
22K Followers 19K Following The government is failing to keep the public safe from harmful medicines, medical devices & blood products, will you sign my petition calling for change? ✍️👇aussie17 @_aussie17
74K Followers 2K Following Ex-Big Pharma Exec exposing Big Pharma here https://t.co/Siv6DHxZL3 christianity: https://t.co/Q6AXMM7zvV, telegram https://t.co/ngjIelq1HkDr Jonathan Engler MB.. @jengleruk
32K Followers 2K Following Medically & legally qualified. Dad of 4, grandpa of 2, husband (of 1!). No part of the “pandemic” narrative is as it seems. Co-chair Hart Group / exec of Panda.Creating Medicines fo.. @hedleyrees
14K Followers 13K Following Educating honest people in the dangers of gene therapy and other Biologic supply chains, based on facts and evidenceAdnan Al-Daini Ph.D. @respect65
58K Followers 39K Following Dr. Al-Daini - Retired University Engineering lecturer, British citizen born in Iraq.Sonia Elijah @sonia_elijah
42K Followers 2K Following Forensic Investigative Journalist | Broadcaster | Writer I Researcher @TrialSiteN @brownstoneinst @ChildrenChd @TheConWom #CuiBonoPJH Law Solicitors LL.. @pjhlaw
49K Followers 1K Following #Stamford and #Corby based employment law experts helping employers and employees locally and nationally. #ukemplaw #HR RTS do not imply endorsements💜Anne W. 💜💜 @AnnieWBelle
6K Followers 2K Following 💜Heartbroken mum wanting justice for my wonderful son who was killed by the AZ covid vaccine and died aged 32. Seeking justice for all vaccine harmed💔🙏💜Kevin McKernan @Kevin_McKernan
81K Followers 3K Following Cannabis Genome Project,2011. Developed the SOLiD sequencer. R&D lead Human Genome Project at MIT/WIBR. Founder- Medicinal GenomicsMalcolm Watt @malcolmwatt
310 Followers 2K FollowingCrazy Magpie @magpie_crazy
262 Followers 479 Following Ex Pharma ▪️ ▪️ ▪️ Advocate for medical ethics, free speech and justice ⚠️Trolls will be ❌ PhD in Bullsh!t DetectionJohn Watt @BringTheNoise_X
2K Followers 147 Following Vaccine injured Bring The Noise Podcast New Account due to other one being hacked!Healthy Living Activi.. @AbFabFit
1K Followers 2K Following Exercise Empowerment Coach💪Outdoor Personal Trainer🌳Mother Nature Protector🌍Multipotentialite✨ FreeThinker 🧠 LibertyLover💜#HealthFreedom Fighter✊ ❌💉☠️🚫BRIAN KENTON BROWN @kentonbrownluv
397 Followers 3K Following I'm not afraid of death; my only fear is coming back reincarnatedCallie Lamoureaux @c_lamourea
39 Followers 5K FollowingWacky Mac 🇺🇸 - .. @djmac2410
4K Followers 7K Following I'm a MAGA Trump Guy, I'm an Army Veteran! GOD Bless the USA🇺🇸🙏. I'm Donald J. Mac Millan. Not a sugar daddy, I'm retired & poor. NO DMs...Stacia Doward @stac_dow
83 Followers 5K FollowingGabriella Burgey @burgey_burg
55 Followers 5K FollowingBarely Bruised Books @BarelyBook
5K Followers 4K Following Fine used bookstore. Open 11am-7pm during the week,noon-6pm on the weekend. 613-981-7718. https://t.co/UAOwJmwVc7Gracie-may Chears @GracieChea
44 Followers 5K FollowingJulia @J_Angeline1
2K Followers 908 Following Author / Bookworm / Follower of YHWH ♥ ✨ I share scriptures & recipes. ✨Sarah Marsh-Collings @smarshcollings
461 Followers 669 Following Lover of #dogs, #food, #wine language. #OU #Geoscience alumni. Mum to #SpringerSpaniel & rescue #SpanishBreton. 🐶🐾 #DigitalMarketing @babelmonkeymeLisa Hamilton @LisaHamilt45910
0 Followers 5 FollowingNatasha Reynolds @NatashaRey99194
0 Followers 6 FollowingGilda Neve @Gilnev2
188 Followers 607 FollowingKim Gray @graykim1971
0 Followers 5 FollowingLesley ✝️🙏❤�.. @gracelandqueen
9K Followers 6K Following Christian. Faith , food and a bit of fun ! I stand for bodily autonomy and freedom.I only comply with Gods word . I will defend His word til I die 🙏DD Denslow 🇬🇧 @wolsned
78K Followers 12K Following Chemist | English 🏴 Changing My Algorithm - Raising money & awareness for the vaccine injured (https://t.co/ddZKb3AjP1)Amy Thomas @AmyThomas332417
0 Followers 4 FollowingFuneral Bags 🐭 @Funeral_Bags
198 Followers 232 Following I am one of the ones they are going to have to find a different way to kill.Cheyenne Tupper @TupCheye
68 Followers 5K Followingmeggie @meggiejo1
152 Followers 571 FollowingChristine Quave @ChristineQ56437
78 Followers 5K FollowingStevie Bird @StevieBird_
2K Followers 2K Following Citizen | Entrepreneur | Health Advocate https://t.co/NftEmca4WC https://t.co/IxyXqGptbG https://t.co/ucBMJMggNrNatati @Natati463599
46 Followers 2K FollowingCarmon Muysenberg @MuysenberCar
55 Followers 5K FollowingGlynda Garton @GartonGlyn88085
71 Followers 5K FollowingMuhammed Bojang @MuhammedB24952
60 Followers 3K FollowingDr Clare Craig @ClareCraigPath
243K Followers 996 Following Co-Chair HART group. Diagnostic pathologist, lover of data, digital pathology and AI, sceptical but optimistic. Views my own not the RCPath's.The Freeman @james_freeman__
91K Followers 2K Following Watch me live 1-3PM GMT daily on https://t.co/7XVpCJwKnJ, Former Member of EU Parliament & @ONS statistician - #WeAreTheResponseAlex Mitchell @ake2306
34K Followers 16K Following VITT (VACCINE INDUCED THROMBOTIC THROMBOCYTOPENIA). There are 445 VITT's and tragically 81 fatal cases. https://t.co/6TIq6Fe5l9Bev Turner 🌸 @beverleyturner
178K Followers 10K Following Mid-morning co-host of Britain's Newsroom on @GBNEWS 9.30am - 12pm, Monday to Thursday. Opinionated but willing to listen. Likes a drink.John Bowe @JohnBoweActor
147K Followers 2K Following Safe and Effective, a second Opinion…..Oracle Films, Highwire, Epoch Times etcRenée Hoenderkamp @DrHoenderkamp
126K Followers 1K Following Doctor/Mum/NHS GP. TalkTV presenter. Daily mail/Mail online author. Inside Out. Views my own, not my employer's. https://t.co/xZs5rUYwH1Jikkyleaks 🐭 @Jikkyleaks
96K Followers 3K Following Home for @jikkykjj the whistleblowing lab mouse #Modernagate #CTCCTCGGCGGGCACGTAG #3Tablets Pronouns: mouse/mouseself Tweets are public interest disclosuresProf Norman Fenton @profnfenton
81K Followers 495 Following Making sense of math, probability & risk. Bayesian. Causal knowledge + data https://t.co/ha2Pu8ddR5 https://t.co/sTrkeY8CM9Adam Rowland MSc @oneadds
26K Followers 3K Following Physio/S & C Trainer- 16yrs Pro sport; Ballet ,Rugby, Military, PGA tour, severely injured due to AZ 💉 vaccineDr Ahmad Malik @DocAhmadMalik
169K Followers 1K Following Hi, I'm Doc Malik, advocating for medical ethics, freedom of speech & good health. Cancelled because I dared to speak the truth. https://t.co/yyjGPrmqzeDr Anthony Hinton @TonyHinton2016
85K Followers 1K Following Consultant Surgeon 30 years experience, retired from NHS. My own personal views, retweets not endorsements, maybe interesting. Now also on GETTR @DrTonyHintonJamie Jenkins @statsjamie
94K Followers 748 Following Political & Economic commentator | Previously head of health/jobs/wages stats @ONS | Stint at @BBC | Award-winning statisticianChris 🐭 @chrislittlewoo8
45K Followers 15K Following Truth, Justice, Honour & Integrity are keystone principals to live life. it’s a disgrace that our current elected representatives have no idea of their meaning.Charlotte, The Barone.. @CharlotteEmmaUK
81K Followers 22K Following 🇬🇧UK Producer @ TNT ~ Today’s News Talk ✨@tntradiolive ✨Receipt Keeper ✨Connector of Voices ✨ Former NPC ✨Commentator✨Awake not Woke ✨Loyal to the Foil✨jules serkin @julesserkin
20K Followers 10K Following #Radio presenter @scoffquaff Xmas special show #BBC #PR #health #hospitality Listen: https://t.co/3DXO3weePdJikky the mouse 🐭 @TheJikky
26K Followers 790 Following Fan account for fallen mice #jikkyleaks #openvaet #freejikky #CTCCTCGGCGGGCACGTAG In hibernation - see @jikkyleaks Pronouns: mouse/mouseselfAnna de Buisseret @AnnadeBuisseret
45K Followers 3K Following I am a senior Employment lawyer specialising in discrimination law, disability discrimination inc. mental health discrimination and human rightsTogether @Togetherdec
84K Followers 151 Following Together Association stands for Freedom We want to be #together not segregated We beat V Passports & Mandate https://t.co/8OKTesF1Nc #freeourstreetsSonia Poulton @SoniaPoulton
92K Followers 1K Following Journalist. Broadcaster. Documentary Film Maker. TNT Host. Mum. Has an attitude about injustice & doesn't care who knows it. https://t.co/eJHF81hprzAussie Cossack @aussiecossack
35K Followers 1 Following Broadcasting from Sydney's Russian Consulate since December 2022 for Sputnik News. Follow my main account on Telegram: https://t.co/cHSHDzJUnFThe Notebook Travelle.. @karrichapus
4K Followers 2K Following Mum, writer, independent researcher, C-19 jab injured ❤️🩹David Dickson @dksdata
18K Followers 3K Following 🧐 Retired Disabled UK Police Officer, International Privacy & Compliance Advocate, Cybersecurity Consultant, Researcher, and Forensic Investigator.Stephanie de Garay @shdegaray73
18K Followers 287 Following #truthspeaker #informedconsent #maddiedegaray #trustGodDan Astin-Gregory @danastingregory
25K Followers 4K Following 🎙️ Free Humanity Podcast (15M+) https://t.co/SHTqTkZECbDan Sanderson @DSanderson_85
5K Followers 3K Following Scotland Correspondent at The Telegraph. [email protected]TrialSite News @TrialsiteN
13K Followers 3K Following TrialSite News is the only #digital media dedicated 100% to transparent and open coverage of medical research and developments from around the globe. #realnewsDoctors for Covid Eth.. @Drs4CovidEthics
43K Followers 280 Following Doctors and scientists from around the world upholding medical ethics and human rights in response to COVID-19.Mary Beth Pfeiffer @marybethpf
37K Followers 2K Following Journalist. Author. In this to change this. Join me.Barely Bruised Books @BarelyBook
5K Followers 4K Following Fine used bookstore. Open 11am-7pm during the week,noon-6pm on the weekend. 613-981-7718. https://t.co/UAOwJmwVc7@JRwatch_ON @JRwatch_ON
776 Followers 0 Following Live tweeting of Dr. Kulvinder Kaur Gill’s judicial review applications heard in Ontario Superior Court on April 10, 2024.Jimmy Tobias @JamesCTobias
9K Followers 999 Following Investigative reporter for @thenation, @GuardianUS, and more. FOIA fan, formerly @forestservice. DM/email for Signal. Tips: [email protected]Vaccine Safety Resear.. @VacSafety
36K Followers 714 Following Our mission is to advance Covid-19 vaccine safety through scientific research, public education & support for the vaccine injured. Founded by @stkirschGlobal Government Aff.. @GlobalAffairs
453K Followers 65 Following The voice of X's Global Government Affairs teamNational Citizens Inq.. @Inquiry_Canada
36K Followers 246 Following The NCI is a citizen-led and citizen-funded public inquiry into the Covid-19 health-protection measures taken by all levels of government in Canada.Molly Kingsley @lensiseethrough
19K Followers 2K Following Writer. Political Organiser. Lawyer. Find me: @UsForThemUK, Express, Mail, Tel, Brownstone, Critic. Our new book: The Accountability Deficit, via Amazon.Steve Bird @SJB1969London
167 Followers 120 FollowingTeresa 💜 @Teresa_ingram1
5K Followers 6K Following Thanks to some of my NHS colleagues. Now in Private Medico legal practice.. or I'm at the beach..🧜♀️. MY Dad is vax injured😡Jessica Hockett 🏹 @Wood_House76
58K Followers 111 Following #FreeSpeech | NYC spring 2020 | MIA positive flu tests | #NoPandemic | "Take no part in the unfruitful works of darkness, but instead expose them." - Eph 5:11Shaun Lintern @ShaunLintern
89K Followers 6K Following Health Editor at The Sunday Times. National Press Awards Health Journalist of the Year 2023. Chair of @mjauk. Public interest journalism matters #E17Sling the Mesh @MeshCampaign
6K Followers 3K Following When industry influences healthcare patient safety suffers. Raising awareness of surgical mesh harm #prolapse #hernia #rectopexy #breast #SUI @kathsansomValproateSurvivors �.. @ValproateUK
813 Followers 2K Following Campaigning and researching since 2001 https://t.co/7gZQBaUmps https://t.co/Osc6DXW87iKay Lacey @KELacey
151 Followers 245 Following Historian. Medieval & Tudor History. King Henry VII. London. Textiles. Trade. Economy. Urban Growth.Roman Bystrianyk @RBystrianyk
5K Followers 363 Following Coauthor with Suzanne Humphries, MD, on the book Dissolving Illusions & coauthor with Kathryn Schmutter on the book Moving Back from MidnightDavy Crockett @Davy1836
2K Followers 955 Following Brian Roberts (not actually Davy Crockett), Christian, husband, father, Co-Founder Grayson County Conservatives and Americans for Health Freedom. Save Texas!David Challen @David_Challen
40K Followers 3K Following Domestic Abuse Campaigner | Survivor | Advisor | Speaker | Writer | Freed my mum #SallyChallen in a landmark #CoerciveControl case, #SallysLaw ⚖️MurrayBlackburnMacken.. @mbmpolicy
10K Followers 2K Following Edinburgh-based policy analysis collective, with a background in policy-making, research & communications. By @kathmurray1 @LucyHunterB & @lnmackenzie1John Olooney @OlooneyJohn
54K Followers 114 Following The vaccines were never about Covid, Covid was about the vaccines, but what do I know, I’m only an undertaker.. https://t.co/8Ead9h6IsGSteve Bowie #Vax Inju.. @bowie792
2K Followers 2K Following Medically disabled after AZ . The mainstream media are only prepared to show one side of the story, I'm the other side 🙏.Debra Scott @DebandezScott
6K Followers 5K Following After being diagnosed type 2 diabetic in Dec '17 & finding out how to put it into reverse from fellow diabetics I made this video https://t.co/v1qafm89FqPhilip Davies MP @PhilipDaviesUK
23K Followers 4K Following Re-tweets only. To contact me please email: [email protected]. Promoted by Philip Davies of First Floor, 3 Manor Lane, Shipley, BD18 3EAGraham Atkinson @TheRedPillPharm
2K Followers 908 Following After over 30 years in NHS senior management roles I left the allopathic system to help build something that is Naturally BetterThailand Medical News @ThailandMedicaX
4K Followers 4K Following Latest Medical, Health, Research, Outbreak, COVID-19, Long COVID & H5N1, Monkeypox, Dengue, Measles, STIs, TB, HIV, Cancer, Glucoma, Diabetes and Herbal News.Alex Finn @AlexFinnX
198K Followers 7K Following Building an X empire. Live content every day at 4pm EST (turn on notifications) | My dope company: @1PercentBetterXCelia Kitzinger @KitzingerCelia
12K Followers 8K Following Hon Prof Cardiff,Co-Director @OpenJusticeCOP + @CDOCuk Observed 534 COP hearings since 1st May 2020 Lake District hike, swim, bikeCharlotte Gaynor @CharlotteChath
136 Followers 1K FollowingCOVERSE @CoVerseAU
2K Followers 101 Following Patient-led charity that supports Australians who have been adversely impacted by their COVID-19 vaccinations.Richmond (Yorks) @Richmond_Yorks
308 Followers 113 Following Richmond Conservative Association - Supporting the work of Rishi Sunak - 01609 772060 or http://t.co/excYbMgmCn for membership and eventsAJ Roberts @ajrobertsshow
18K Followers 804 Following 🇬🇧Former UK Soldier | 🎙️Host of The AJ Roberts Show | 👁️ Soul Mission Activator | ♟ Chess Player | 🙏 Obsessed With Quantum HealingThey Keep Saying Its .. @mRNAdeaths
11K Followers 4K Following Reporting Vaccine Adverse Events from Around the Globe "We traded temporary infections for permanent disabilities" #Pfizer #Moderna #AstraZeneca #mRNALesley ✝️🙏❤�.. @gracelandqueen
9K Followers 6K Following Christian. Faith , food and a bit of fun ! I stand for bodily autonomy and freedom.I only comply with Gods word . I will defend His word til I die 🙏Ryan sikorski @Ryansikorski10
17K Followers 684 Following 🇺🇸Patriot🇺🇸critical thinker + ?? asker/ open-minded individual. Evolving my mind + seeker of knowledge. Humanity lover/seed planter.Spiritual 1🙏🙏Anette Lindberg Fried.. @anettefri
6K Followers 1K Following 🇩🇰vaccine injured by Pfizer 💔🫁… Chairman: https://t.co/ZoJ0xXxyMLPatent SUN @Patent_SUN
4K Followers 4K Following 🐭🇯🇵Japanese patent attorney specializing in patent. Stand up against the mRNA problems. We must not be bystanders of history repeating itself.Julian Malins K.C. @JulianMalins
3K Followers 2K Following K.C. Barrister at Malins Chambers, Temple Avenue, London. Reform U.K. party activist.Dr Dean Patterson @mottomeneki
7K Followers 5K Following MBchB, FRCP Views expressed are my own and not that of my partnership.Lymphoma Hub @lymphomahub
9K Followers 2K Following A global education platform providing clinical updates on a range of lymphoma subtypes and chronic lymphocytic leukemia (#CLL) #lymsmJust received an invitation to an important USP two-day online Workshop on Endotoxin Measurement. It is free! geoffpain.substack.com/p/how-did-i-ge… @Kevin_McKernan @JesslovesMJK @CanningPharm @karrichapus @JanJekielek @MarinatZhang @MaryanneDemasi @SuziHoutz @Shirl3yBell @tatiann69922625
@Jikkyleaks @PaulaJardine @ChrisEd16512812 @itsthemnotus Lipid nanoparticles: The game-changer in CRISPR-Cas9 genome editing pubmed.ncbi.nlm.nih.gov/38288017/
Novak Djokovic awarded World Sportsman of the year. His refusal to take the Covid vaccine cost him millions of dollars. He is a hero not only in tennis but for standing up for his rights.
@DrJBhattacharya Have you seen this? This student declaration pays homage to you, @MartinKulldorff & @SunetraGupta for the GBD launched on the same day (3 years later!): studentdeclaration2023.org Please help us build momentum & HALT college mandates! Yes, still happening at almost 80 US colleges!
Students: stand up & say NO MORE! Everyone, please sign the declaration to support students still under mandates —> studentdeclaration2023.org Check out the website for info & if you believe you’ve been injured: StopCollegeMandates.org 🚨🚨🚨
@ChrisEd16512812 @itsthemnotus @mRNAdeaths @PaulaJardine That is why they are in a patent battle.
@mRNAdeaths People need to understand the significance of #taggate. The 3 GMO "codon optimised" vaccines (Pfizer, Moderna and Novavax) do not have random codon optimisations. They converged at one specific sequence, that just happens to make you #CRISPRready. x.com/jikkyleaks/sta…
@TrialsiteN Is that because we caught them out having colluded to conserve a gene sequence between all the companies that just happened to have a PAM sequence? Bookmark this sequence 👇👇👇👇👇👇👇 ATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGG #CRISPRgate @JesslovesMJK @AdhesionsOrg
@TheFigen_ That's called a great team work! 👏
🛑 Treason. Please read this excellent article by my friend @JohnStone32
Can we get one thing clear: the British government knew there was no emergency in March 2020 and policy was deliberately misdirected @jeffreyatucker @toadmeister @XPCBirmingham @ABridgen @Johnincarlisle @SeanBFlanagan @JeffreyPeel @lensiseethrough ageofautism.com/2022/06/the-br…
BREAKING - New study shows that women injected with COVID-19 mRNA vaccines experience a 34% lower pregnancy rate when undergoing IVF treatment compared to unvaccinated/uninfected women. The study also found that unvaccinated/uninfected men had more than twice the sperm…
🌍 South Africa becomes the first African country to debate the WHO’s I.H.R 2005 amendments and proposed new pandemic treaty in Parliament 📍WHO's monopoly over health is a national elections issue for every country. Proper public participation, parliamentary oversight and an…
Most famous for her personal triumph over the limitations of both blindness and deafness, Helen Keller was one of the twentieth century's leading advocates for individuals with disabilities.
This makes my blood boil. 🤬 Never let people forget the suffering that was inflicted on humanity under the guise of "the science".
@eekymom You’re most welcome 😘. Their Internet clean-up operations are not scrupulous enough & there are breadcrumbs of evidence left everywhere.. For the record, the study demonstrates that the vaccines had no discernible effect on transmission…unsurprisingly. thelancet.com/journals/lanin…
A (fairly rare) example of great PR/communication. Clear update explaining what happened, how it happened, and why everyone needs to move along, please.
An update following this morning’s incident with Household Cavalry Mounted Regiment horses in London. Three of our soldiers are being treated for non-life-threatening injuries. Our horses are also safe, and are undergoing veterinary care. (1/2)
@ChrisEd16512812 @FraserNelson @zoeharcombe Hmmm - that’s what came to my mind too! Hard to forget.
This performance is strong, but I’ll never forget how Andrew Neil lost his moral compass during Covid.
'Stay the hell out of it.' Andrew Neil's advice on what the government should do with the media