HudsonAlpha @hudsonalpha
A nonprofit institute where scientists, educators, clinicians and entrepreneurs collaborate and apply genomics to improve the human condition around the globe. hudsonalpha.org Huntsville, AL Joined July 2009-
Tweets15K
-
Followers7K
-
Following3K
-
Likes3K
Congrats to our #GCA Amber Glaze on matching at UNC Greensboro for genetic counseling🧬 We are so proud of you and can't wait to see what you do next!
Thank you to the great folks at @TheSabanCenter in Tuscaloosa for visiting @hudsonalpha earlier this week! We had a great conversation about the future of STEM collaboration across the state.
📣 SPONSOR SHOUTOUT! Thank you to @Bayer, for sponsoring CROPS 2024! Bayer is a global enterprise with core competencies in the life science fields of healthcare and agriculture. We can't wait to see you this June. Want to sponsor #CROPS2024?: hudsonalpha.org/crops/sponsor/
We are proud to be counted as one of @huntsvillecity #BestPlace4WorkingParents in recognition of our family-friendly practices that help our employees and our business thrive! @BestPlace4WP
EXHIBIT HALL: @agbt Ag 2024 Exhibit Hall @ElemBio @CompleteGenomic AgriPlex @AlitheaGenomics Arizona Core Network @BCILifeSciences @biomodalhq @FerrisGenomics @hudsonalpha Mirxes @NeogenCorp @NEBiolabs @nanopore @PacBio @ParagonGenomics @PhaseGenomics SGS @thermofisher #AGBTAg
This past Friday @hudsonalpha had a "Dean's Dawgs" walk for kidney-related diseases on the Double Helix at McMillian Park. You can support Dean and others by contributing to Alabama Kidney Walk & Celebration by using this link: alkf.convio.net/site/TR/Events…
It’s your last chance to grab tickets for the 2024 Spring Benefit! Go behind-the-scenes of the life-changing work led by HudsonAlpha's plant scientists to protect our future The event will be at @HsvMeetings on April 25 at 6 p.m. Get your tickets now: donate.hudsonalpha.org/event/2024-spr…
We are proud to support @hudsonalpha and the Alabama Office of Minority Affairs as they strengthen and diversify tomorrow's STEM workforce through their HBCU Co-Op internship program 🔬 Learn more: bit.ly/4bdwpvd
It’s National Internship Awareness Month! We are so excited to meet this summer's cohort of BioTrain interns in just a few weeks! You can learn more about the program and the impact that it's made throughout the years here: hudsonalpha.shorthandstories.com/15-years-of-bi…
We're breaking down our DNA in Motion video series! This series makes science fun, accessible and visually captivating. This is part two of our first installment, "How Scientists are Using Genomics to Improve Life." You can watch the entire video here: hudsonalpha.org/everyday-dna-i…
📣 SPONSOR SHOUTOUT Thank you to our silver sponsor, @PacBio, for sponsoring CROPS 2024! PacBio is revolutionizing genetic sequencing systems so researchers can revolutionize genomics🧬 Are you attending #CROPS2024 and want to sponsor: hudsonalpha.org/crops/sponsor/
It’s National Internship Awareness Month! Our HudsonAlpha, @Alabama_OMA Co-op internship helps students gain experience in STEM. It provides students enrolled in minority serving institutions with hands-on experience. Get to know our current cohort: foundation.hudsonalpha.org/alabama-power-…
Meet Dr. Susan Hiatt, our latest Face of Innovation! Read more about Susan's career journey, new role, and future plans for rare disease diagnosis: hudsonalpha.org/faces-of-innov…
UPCOMING GRADUATES! We want you for a year-long, full-time paid fellowship at HudsonAlpha! Gain experience working in a research lab! The @NSF-funded BRIDGES fellowship is available to recent graduates from any Alabama HBCU. Learn more & apply today: hudsonalpha.org/bridges/
April is National Minority Health Awareness Month! HudsonAlpha works hard to remove healthcare barriers. The Information is Power initiative makes cancer genetic testing more accessible by offering low-cost cancer risk tests across Alabama. Learn more: hudsonalpha.org/information-is…
"This was the most complicated genome sequence we’ve yet completed. It shows how far we’ve come. This is the kind of thing that 10 yrs ago people thought was impossible.” -Jeremy Schmutz @jgi @hudsonalpha @jbei @BerkeleyLab @phytozome @doescience @Nature newscenter.lbl.gov/2024/03/27/swe…
Registration for CROPS is open now! We want you to join us for one of the largest agricultural conferences in the Southeast this summer. Join us at HudsonAlpha from June 3-6. We can't wait to see you at #CROPS2024: hudsonalpha.org/crops/attend-c…
Discover how plant genomics at HudsonAlpha is helping to feed the world, improve sustainable agriculture, & protect our planet at our upcoming Spring Benefit! You'll get to know Dr. Josh Clevenger & other members of our plant genomics team as they share about their research.
We're breaking down our DNA in Motion video series! This series makes science fun, accessible and visually captivating. This is part one of our first installment, "How Scientists are Using Genomics to Improve Life." You can watch the entire video here: hudsonalpha.org/everyday-dna-i…
We love our grad students! During this National Graduate Student Appreciation Week, we want to highlight our three incredible grad students. Zach Meharg, Laramie Aközbek & Wren Jenkins work incredibly hard and we are so grateful they chose HudsonAlpha to work on their research!
Alex Harkess @aeharkess
5K Followers 2K Following Plant reproduction and evolutionary genomics. Faculty Investigator @hudsonalpha
Richard Shelby @SenShelby
96K Followers 546 Following The official Twitter page for former U.S. Senator Richard Shelby (R-Ala.)
Dr. Sarah Carey @sarahbcarey
868 Followers 711 Following USDA NIFA postdoc in Harkess lab @ HudsonAlpha | Evolutionary genetics | Comparative genomics | Sex chromosome evolution | she/her
Sebastian S. Cocioba�.. @ATinyGreenCell
24K Followers 8K Following Amateur 🌿 Biologist • Aspiring 🌺 Designer Researcher at Binomica Labs • Degreeless Heathen • Petunia Breeder • Open Lab Notebook: https://t.co/umYTLluuuw
Charity Goeckeritz, P.. @CherrityG
2K Followers 1K Following @NSF postdoc in the Harkess Lab @hudsonalpha studying apomixis in Rosaceae 🍎🌸Here for the polyploids. Remember science is done by people. she/her #WomeninSTEM
Huntsville Utilities @HSVUtilities
21K Followers 199 Following Publicly-owned electric, natural gas & water utility serving Huntsville & Madison County, AL. Profanity will not be tolerated. EEO statement on our website.
PacBio @PacBio
46K Followers 3K Following Our mission is to enable the promise of #genomics to better human health by creating the world’s most advanced #sequencing technologies. #PacBio
Clement Chow @ClementYChow
17K Followers 5K Following henfluencer - geriatric millennial - #stopasianhate - don’t call me Clem - emotional eater™️- he/him- @chowlab
Matthew S. Alexander @Matt_Muscle_Guy
5K Followers 4K Following Geneticist, Skeletal Muscle, Drug development, Gene therapies. Non-coding RNA, and Zebrafish Aficionado. All tweets are my own. Instagram @thealexanderlab
News 19 @whnt
140K Followers 3K Following We are North Alabama’s News Leader and Weather Authority. Tag us in your news tips. Use #valleywx for weather photos.
City of Huntsville, A.. @huntsvillecity
44K Followers 670 Following City government for #HuntsvilleAL. A smart, innovative and inclusive city located in North Alabama. Known around the globe as Rocket City, USA.
National Human Genome.. @genome_gov
81K Followers 447 Following Funding research at the forefront of genomics to improve human health. Formerly the Human Genome Project. https://t.co/4hdQRFkFNU
Bri Rogers, PhD @bbrogers_
277 Followers 391 Following Postdoc in Cochran Lab @HudsonAlpha | PhD from @UABNews | Neurogenetics
Huntsville Sports Com.. @HsvSports
3K Followers 3K Following The HSC promotes and enhances the quality of life in Huntsville by identifying, recruiting, promoting and staging sporting events. We Do Sports. #SportsHsv
mary williams @PlantTeaching
23K Followers 12K Following Promoting SciComm, teaching, equity & inclusion in plant biol PI NSF RCN: ROOT&SHOOT. Features Editor @ThePlantCell @PlantPhys. @[email protected]
Jeremy Day @DayLabUAB
5K Followers 2K Following UAB Neurobiologist and Director of the UAB Comprehensive Neuroscience Center. Full justification and Oxford comma advocate.
Jazmine I. Benjamin, .. @J_I_Benjamin
5K Followers 4K Following she/her/that girl • Medical Science Liaison - Rare Diseases • Opinions = my own, RTs ≠ endorsements
Tommy Battle @TommyBattle
12K Followers 316 Following Father. Grandfather. Christian. Mayor of Huntsville.
Anantha Korrapati @AKorrapati18
36 Followers 256 Following NIH IRTA Fellow | Neuroscience | Genetics | Health Policy | Environmental Health | Incoming Student at UAB Heersink School of Medicine 🐉
Kotodama Buddha @BuddhaBama
1K Followers 5K Following Learn, Do, Live. AgriScience & FFA Educator. Master of Non-Compliance as Art.
A_JaneD_M8 @M8Janed40721
6 Followers 813 Following
McThite @mc_thite37210
0 Followers 318 Following
Taylor Lamon, NBCT @mrslamon
460 Followers 534 Following STEM Innovation • Saban Center • TCS • Young Tuscaloosa Membership Chair • Former STEM Coordinator & GR5 Teacher • University of Alabama Alum
Mohsen @Mohsen1080
612 Followers 737 Following PD Research Associate | Plant Breeding & Computational Biology. Interested in Omics & Climate Smart Plant Breeding & Bigdata. AE: @FrontPlantSci @plantphenomej
Rogue_Radiance @RadianceRo70172
19 Followers 780 Following
Miriam Dillard Stroud @miriam_stroud
77 Followers 652 Following
Kabuki Syndrome Found.. @kabukisyndrome
163 Followers 148 Following KSF is driving research for this rare disease through fundraising, knowledge-sharing, and collaboration. Join us to learn more and take action.
Melissa Tosiano @MTosiano
146 Followers 514 Following Post-transcriptional regulation of C. albicans filamentation. PhD candidate @ CMU bio, genuinely fun-gal, rustbelt cool, RNA superfan! (she/her)
François Lecoquierre @francois_leco
175 Followers 149 Following
Nafisa Nuzhat @nnuzhat
237 Followers 371 Following Postdoc studying photoreceptor cells and their role in maintaining our vision 👩🏽🔬👁 🔬 // photographer 📸 // chocolate covered strawberries are life
PrakashDrpraks34 @drpraks3452171
25 Followers 760 Following
LmnsTide_16 @lmnstide3363
7 Followers 1K Following
Evan Groover @evan_groover
976 Followers 1K Following Building CRISPR tools and techniques for plants.
Moira_US_ @MoiraUs62693
7 Followers 1K Following
Guido Barzaghi @BarzaghiGuido
430 Followers 1K Following PhD student at @EMBL with the Krebs and Zaugg labs. TF binding, TF cooperativity, Bioinformatics, SingleMoleculeFootprinting.
Megan Duffy @MeganDuffyPhD
4K Followers 5K Following Neuroscientist | @NIH NIA IRP ➡️ ERP | Aging & Neurodegeneration | Spartan PhD | Hoosier 🏀 | Neurospicy | Views: Mine/Personal Acct. | she/her
MamaPanda2270 @MamaPanda2270
333 Followers 392 Following Scientist 👩🎓 Gamer 🎮 Streamer 🎥 Creator 🐼 Socially Unacceptable I’ll leave this here 🤷♀️
Antonei B Csoka, PhD @abcsoka
117K Followers 967 Following Associate Professor, Dept. of Anatomy, Howard University | https://t.co/ZoS8nRaIkS | CEO, Vision Genomics, LLC | #NoAging #Science
Marcos Letaif Gaeta @mlgaeta
36 Followers 1K Following
April @alack898
38 Followers 741 Following
Debolina Ghosh @DebolinaOnNet
13 Followers 132 Following Connecting the dots.. Research Fellow at IIT Guwahati, India
John Greeley 🧬 @johnnygenomics
292 Followers 5K Following Clinical Bioinformatics in Molecular Pathology. Rhodieland diasporan in Camberville. Pro-Democracy, Anti-Fascism.
Hanu_manth825 @manth82552460
26 Followers 904 Following
p11bais17l @kc2l83ksg
2 Followers 237 Following If you want to make friends, you can contact me anytime TG：https://t.co/zRps945tFS WS：https://t.co/nCVkb1axbG
john @john28515900
166 Followers 2K Following
Amy Lyons @AmyLyons_AMSTI
97 Followers 114 Following AMSTI 6-8 science specialist for Athens State. Dog rescuer. Science nerd. Christian.
Zinan Wang 王子楠 @zinan_wang
364 Followers 1K Following Arthropod biologist. Study the evolution of arthropod physiology and their adaptation to diverse and extreme environments.
BigBlueWaveUSA® 🇺.. @BigBlueWaveUSA
154K Followers 146K Following #SaveDemocracy #BidenHarris #BlueCrew #FBR #BlueVoices #DemVoices 💙 #VoteBlue2024 #ConnectBlue #IFB - 2024 is Democracy vs Fascism #TEAMSTALLION
Erika R. Moore-Pollar.. @erikarmoore11
371 Followers 451 Following University of Memphis, PostDoc in the Mandel Lab - Studying #phylogenomics and #systematics of the genus #Packera 🌼 She/her/hers.
Boaz Babai @IsraelTechNews
29K Followers 17K Following Brand awareness and business impact for Israeli #B2B companies with innovative products and services.
Hidden Variable @KuriousSphere
766 Followers 2K Following
Dev Raj Bhattarai @DevRaj1015
16 Followers 42 Following Graduate Research Fellow | Genetics Genomics and Bioinformatics | Heersink School of Medicine | University of Alabama at Birmingham
Logan Havard @logan_havard
26 Followers 397 Following Graduate Student @auburnu | Evolutionary Genetics 🧬🔬| “We are made of star stuff” ✨ | Nullius in verba
ProfNoctis 🔜 FF7 R.. @ProfNoctis
4K Followers 1K Following I was born to teach and play video games. I do both at the University of Alabama. | PROFESSOR | YOUTUBE PARTNER | business: [email protected]
katie marlow @katiegmarlow
6 Followers 83 Following genetics phd student @uab_gbs. @auburnu alum. tell your dog i said hi! she/her
ashrafbiochem @ashrafbiochem
302 Followers 2K Following PhD Department of Sciences of Agriculture, Food, Natural Resources and Engineering (DAFNE) University of Foggia Via Napoli 25 71121 Foggia, Italy
Choukri Ahmed 🧬�.. @Choukri607A
162 Followers 1K Following Ph.D. scholar Plant – Plant trophic interaction Nantes Uni-🌱🇫🇷// https://t.co/3GZ8Yi4LqG. Applied Plant Biotechnology Cadi-Ayyad univ. 🇲🇦 // Music snob.
Bilal Ahmad @BilalAhmad252
98 Followers 425 Following Plant Molecular Biology Bioinformatics Computational Genomics
George Stack @geo_stack
530 Followers 479 Following Cornell Postdoc | Plant breeding and biotic interactions | Fond of bees, Christmas trees, and hemp. he/him
vikasahuja @vikasahuja
172 Followers 1K Following Technical Program Manager at https://t.co/0lXeSHaH4b and passionate about Cloud Services.
Ademola Aina @amb_ademola
542 Followers 1K Following Plant Genetics and Genomics of America’s most controversial feral crop (Cannabis Sativa L.) | Computational Biology | Data Science |
Alex Harkess @aeharkess
5K Followers 2K Following Plant reproduction and evolutionary genomics. Faculty Investigator @hudsonalpha
Richard Shelby @SenShelby
96K Followers 546 Following The official Twitter page for former U.S. Senator Richard Shelby (R-Ala.)
Dr. Sarah Carey @sarahbcarey
868 Followers 711 Following USDA NIFA postdoc in Harkess lab @ HudsonAlpha | Evolutionary genetics | Comparative genomics | Sex chromosome evolution | she/her
Jason Simpson @simpsonWVTM13
56K Followers 18K Following Meteorologist at WVTM 13 in Birmingham. Parent liaison @PC4Quality, advocate for CHD, Castin' 'N Catchin' charity bass tournament.
Charity Goeckeritz, P.. @CherrityG
2K Followers 1K Following @NSF postdoc in the Harkess Lab @hudsonalpha studying apomixis in Rosaceae 🍎🌸Here for the polyploids. Remember science is done by people. she/her #WomeninSTEM
Huntsville Utilities @HSVUtilities
21K Followers 199 Following Publicly-owned electric, natural gas & water utility serving Huntsville & Madison County, AL. Profanity will not be tolerated. EEO statement on our website.
PacBio @PacBio
46K Followers 3K Following Our mission is to enable the promise of #genomics to better human health by creating the world’s most advanced #sequencing technologies. #PacBio
Clement Chow @ClementYChow
17K Followers 5K Following henfluencer - geriatric millennial - #stopasianhate - don’t call me Clem - emotional eater™️- he/him- @chowlab
News 19 @whnt
140K Followers 3K Following We are North Alabama’s News Leader and Weather Authority. Tag us in your news tips. Use #valleywx for weather photos.
City of Huntsville, A.. @huntsvillecity
44K Followers 670 Following City government for #HuntsvilleAL. A smart, innovative and inclusive city located in North Alabama. Known around the globe as Rocket City, USA.
National Human Genome.. @genome_gov
81K Followers 447 Following Funding research at the forefront of genomics to improve human health. Formerly the Human Genome Project. https://t.co/4hdQRFkFNU
Michael Schatz @mike_schatz
16K Followers 1K Following Bloomberg Distinguished Professor of Computer Science and Biology at Johns Hopkins University
Aaron Quinlan @aaronquinlan
17K Followers 1K Following Genome mutation, software for genomic discovery. https://t.co/6GKjALLFfk Co-director, DELPHI Data Science Init.: https://t.co/8uWRcIzWRr
mary williams @PlantTeaching
23K Followers 12K Following Promoting SciComm, teaching, equity & inclusion in plant biol PI NSF RCN: ROOT&SHOOT. Features Editor @ThePlantCell @PlantPhys. @[email protected]
Jeremy Day @DayLabUAB
5K Followers 2K Following UAB Neurobiologist and Director of the UAB Comprehensive Neuroscience Center. Full justification and Oxford comma advocate.
Jazmine I. Benjamin, .. @J_I_Benjamin
5K Followers 4K Following she/her/that girl • Medical Science Liaison - Rare Diseases • Opinions = my own, RTs ≠ endorsements
Tommy Battle @TommyBattle
12K Followers 316 Following Father. Grandfather. Christian. Mayor of Huntsville.
huntsvillealcoc @huntsvillealcoc
9K Followers 2K Following The Mission of the Huntsville/Madison County Chamber is to prepare, develop and promote our community for economic growth. #hsvcoc #asmartplace
James Lawlor @james_lawlor
188 Followers 320 Following A Clever Jack who Entertains. Computational biologist @HudsonAlpha (don't speak for them); choral singer; actor; photos; games; jack-of-all-trades
OmniVis @OmniVisTech
441 Followers 438 Following Rapid food borne pathogen detection technology 🦠 Experience the power of the lab in the palm of your hand 🔬
Tanner Coleman @tcolemangc
484 Followers 500 Following Genetic Counselor @HudsonAlpha and @SmithGenomicMed | @uncggc '21 🧬 🧗♂️ 🥏 🏐 Tweets are my own. he/him
HBCU Buzz @HBCUBuzz
106K Followers 529 Following ✊🏾🤎 HBCU news, insights and editorials from the Black College community. Since 2011 | #HBCUBUZZ
Catherine Coleman Flo.. @CathFlowers
6K Followers 3K Following Fighting for environmental justice with https://t.co/IbIZy6JnxP. Rural development @EJI_org. Board member @climatereality & @NRDC. 2020 #MacFellow. Author of "Waste."
Carter Wright, PhD @ChIPseqCarter
118 Followers 226 Following LGG Fellow | UT Southwestern Medical Center | PhD - @hudsonalpha | Genetics & Genomics 🧬
IVLP @StateIVLP
40K Followers 1K Following Official account for the International Visitor Leadership Program (IVLP), the premier professional exchange program of @StateDept and @ECAatState. https://t.co/bZL4LiK2Zh
HudsonAlpha Wiregrass @HAWiregrass
92 Followers 80 Following @hudsonalpha partnered with the @CityofDothan to spark innovation, enhance STEM education & inspire economic growth in the #Wiregrass region
Adam Kelley @AdamKelley
615 Followers 2K Following Christian/Husband/Father/APR Communication Pro and, quite possibly, the only man in Alabama who doesn't hunt, fish or play golf.
Verified @verified
4.2M Followers 2 Following Individuals can get a blue checkmark with @Premium. Organizations can sign up for Verified Organizations here: https://t.co/uFOsfTiR2A
Sarah Sharman, PhD @sksharman1089
59 Followers 146 Following Research Communication Manager @hudsonalpha | Cat mom | Book nerd | PhD @MCG_AUG
Emily Adelman @emilyadelman32
371 Followers 384 Following Social media & media relations specialist with @hudsonalpha // @NewhouseSU, @SyracuseU ‘19 // PHL-SYR-HSV-SEA
Tiny Expeditions Podc.. @ExpeditionsTiny
46 Followers 63 Following A podcast that explores the tiny science of genetics, DNA, and inheritance from @hudsonalpha. Season 4️⃣ is out now!
Twist Bioscience @TwistBioscience
24K Followers 800 Following Synthetic DNA for Health & Sustainability #WeMakeDNA #TwistBlog #WritingTheFuture #TwistBiopharma #ScienceDoesntStop #DiversityIsInOurDNA
Research Triangle Par.. @TheRTP
30K Followers 4K Following 375+ companies, 7,000 acres, 60,000 employees. Innovation every day, right in the heart of NC.
HuntsvillePatch @HuntsvillePatch
25 Followers 0 Following Local news, alerts, events and more. We're your source for all things Huntsville.
Gila Fridkis @gila_monster03
203 Followers 283 Following
Megan Reyna @MeganReynatv
2K Followers 970 Following Reporter @kens5 • previously @WAAYTV @FOX34 • Texas Tech Alum 👆🏼 • Opinions my own
Dept. of Agriculture @USDA
988K Followers 3K Following Leadership on #food, #agriculture, natural resources, #rural development, #nutrition, & related issues based on public policy, science, & effective management.
Agricultural Research.. @USDA_ARS
45K Followers 2K Following USDA’s principal in-house research agency committed to leading America toward a better future through ag research and information. #DiscoverARS and #ARSAgLab
Priyanka Garg @Priyank61687030
2 Followers 2 Following I am a Bioinformatician Love to take challenges
Tiffany Roy @BlkNBio
32 Followers 154 Following Alabama State Alumni🐝/B.S. Biology Ed./M. Ed. Instructional Leadership @UWA/Future NBCT & Instructional Coach/Mom 2 Jai, Riah, & Kena🎀🎀🎀/Wife to D. Roy💍
Ashley @_pawneegoddess_
10 Followers 137 Following
Scott Givan @sgivan
832 Followers 2K Following Director of the #Bioinformatics and #Biostatistics Core (@varibbc) at the Van Andel Institute (@VAInstitute) #Genomics #Metagenomics
Stuart McDaniel @mcdaniellab
1K Followers 1K Following educator at land grant uni, research on evolutionary genetics, mostly with mosses and other flagellate plants
Mike Barker (@MikeBar.. @BarkerLab
7K Followers 6K Following Plant Evolution @UofAEEB | #firstgen #iamabotanist Tweets are my own. He/him Only posting @[email protected] https://t.co/zByjX5vWyx
Genetic Counselors @GeneticsPros
2K Followers 3K Following https://t.co/iHQrerJwmK is home to genetic counselors worldwide. Our Twitter account has over 1,000 GC's and 400 geneticists following.
Hadley Stevens Smith @hadleyssmith
774 Followers 2K Following Health economist & ELSI scholar researching pediatric genomic medicine. Assistant Professor of Population Medicine @CHERP_DPM @PROMoTeR_DPM. @GenetxValue
Laramie (Smith) Aköz.. @nature_of_words
594 Followers 1K Following Comparative & Evolutionary Genomics in Myricaceae, PhD Student in the Harkess Lab || #NSFGRFP fellow || B.S. in Plant Bio from @uga_plantbio || 🐞
😷Courtni Kopietz�.. @CKopietz
581 Followers 1K Following Marketing manager + strategic comms. Boss of @nerdniteomaha. Grad of @UNCmedsciJourn. She/her/hers. Tweets are my own.
ALH_Foundation @FoundationAlh
29 Followers 77 Following Mission: To build relationships and broaden financial resources to sustain the health care programs, projects, and services of Athens-Limestone Hospital.
Hadley🧫🌲🔬 @hadley_rosen
22 Followers 111 Following UAB ‘24🐲I SciTech Honors🧪I BMD🧫 I she/her | undergraduate research 👩🔬 | STEM is for everyone 💚
Corey Watson @ctwatson29
873 Followers 1K Following Scientist with interests in population, evolutionary, molecular, and disease immuno/epi/genetics. IG for life.
Seed Today @seedtoday
3K Followers 502 Following Seed Today provides news and information for the seed production industry. Join us to receive links to the latest industry news.
Rishi Bhandari @hreeshee
768 Followers 335 Following Postdoc @USDA_ARS Alumni @potnislab Ph.D. @AuburnU Founder president @YCSA #microbiome #climate change #functional genetics and genomics #ML & AI
Dr. Janelle M. Burke .. @ahungrybotanist
1K Followers 934 Following prof at an HBCU. Botanist. Director of an Environmental Studies program. I support diversity in STEM and climate action NOW.
Stephanie Regagnon @StephRegagnon
2K Followers 4K Following #Ag #AgTech #STL #FuckCancer #Justice #Equality #BLM #Founder #Innovation #Partnerships / Views mine
Nourish the Future @NourishFuture
180 Followers 116 Following A national education initiative developed by science teachers for science teachers that connects students to modern agriculture @unitedsoy @nationalcorn
Molly Stetler @molly_stetler
25 Followers 41 Following Genetic counselor @Invitae and proud @UCSGCprogram & @EmoryUniversity alum. Pizza, ice cream, and DNA are a few of my favorite things! 🧬 New to Twitter 🙋🏼♀️
UAH ΑΤΩ @UAHATO
596 Followers 493 Following We are the men of the Theta Pi Chapter of the @AlphaTauOmega Fraternity at The University of Alabama in Huntsville.
Luke Hajdasz WFSB @LukeHajdaszTV
1K Followers 825 Following New London Bureau Chief @WFSBnews covering the shoreline and Eastern CT l @UConn Graduate l Previous: @WAAYTV Mornings
Omar Rahman @rahman_dna
655 Followers 704 Following Chief of Medical Genetics Department of Pediatrics Weill Cornell Medicine 🏳️🌈
Lindani Moyo @moyo_plantpath
583 Followers 943 Following plant-pathogen-interactions, molecular virology, bioinformatics, microbiomicsCongrats to our #GCA Amber Glaze on matching at UNC Greensboro for genetic counseling🧬 We are so proud of you and can't wait to see what you do next!
Thank you to the great folks at @TheSabanCenter in Tuscaloosa for visiting @hudsonalpha earlier this week! We had a great conversation about the future of STEM collaboration across the state.
LET'S DO COFFEE: @agbt Ag 2024 Exhibit Hall @ElemBio @CompleteGenomic AgriPlex @AlitheaGenomics Arizona Core Network @BCILifeSciences @biomodalhq @FerrisGenomics @hudsonalpha Mirxes @NeogenCorp @NEBiolabs @nanopore @PacBio @ParagonGenomics @PhaseGenomics SGS @thermofisher #AGBTAg
EXHIBIT HALL: @agbt Ag 2024 Exhibit Hall @ElemBio @CompleteGenomic AgriPlex @AlitheaGenomics Arizona Core Network @BCILifeSciences @biomodalhq @FerrisGenomics @hudsonalpha Mirxes @NeogenCorp @NEBiolabs @nanopore @PacBio @ParagonGenomics @PhaseGenomics SGS @thermofisher #AGBTAg
This past Friday @hudsonalpha had a "Dean's Dawgs" walk for kidney-related diseases on the Double Helix at McMillian Park. You can support Dean and others by contributing to Alabama Kidney Walk & Celebration by using this link: alkf.convio.net/site/TR/Events…
We are proud to support @hudsonalpha and the Alabama Office of Minority Affairs as they strengthen and diversify tomorrow's STEM workforce through their HBCU Co-Op internship program 🔬 Learn more: bit.ly/4bdwpvd
DESSERT & COFFEE: The @agbt Ag 2024 Exhibit Hall is packed for some sweets, sponsors, caffeine and tech. Don't miss out! Did someone say churros and chocolate? #AGBTAg @hudsonalpha @AgriplexCLE @ParagonGenomics @PhaseGenomics
Our sponsors bring their best to @agbt Ag! @ElemBio @CompleteGenomic AgriPlex @AlitheaGenomics Arizona Core Network @BCILifeSciences @biomodalhq @FerrisGenomics @hudsonalpha Mirxes @NeogenCorp @NEBiolabs @nanopore @PacBio @ParagonGenomics @PhaseGenomics SGS @thermofisher #AGBTAg
The @hudsonalpha TIMBER Project team visited The Westervelt Company to discuss the power of Alabama pine DNA & the impact on the forestry industry. HudsonAlpha Faculty Investigator Josh Clevenger, PhD, is leading this project! #TIMBERProject #Research
"This was the most complicated genome sequence we’ve yet completed. It shows how far we’ve come. This is the kind of thing that 10 yrs ago people thought was impossible.” -Jeremy Schmutz @jgi @hudsonalpha @jbei @BerkeleyLab @phytozome @doescience @Nature newscenter.lbl.gov/2024/03/27/swe…
The @KodaniLab is moving to Rocket City! We're excited to join @hudsonalpha and continue our mission in rare disease research. So many thank yous to @StJudeResearch over the last few years.
The City of Dothan, @hudsonalpha, @hudsonalphaEcD and HudsonAlpha Wiregrass visited Southern Research and Station 41 in Birmingham. Station 41 nurtures biotechnology startups through an incubator, accelerator, and venture studio. #EconomicDevelopment
We are investing up to $8.5 million in additional funds in SpliSense to conduct a Phase 2 clinical trial to test its antisense oligonucleotide drug for people with #cysticfibrosis who have the splicing mutation 3849+10Kb C-to-T.
Read on for how students contributed to pear breeding through the American Campus Tree Genomes Project 🍐 bit.ly/3U0Ez3Z Learn more about how co-founders @aeharkess of @hudsonalpha & @LeslieGoertzen of @AuburnU set up this invaluable educational course.
5/ The beautiful photo featured on the cover of G3 was taken by Jim Morris of Pear Bureau Northwest.
The City of Dothan, @hudsonalpha, and HudsonAlpha Wiregrass visited Innovate Alabama last week to provide an update on the Dothan City Center project and the Wiregrass Innovation Center. #Innovation #HudsonAlphaWiregrass #InnovateAlabama
Lets get (pop)cultured! Season 5... coming soon!
AATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAGAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAAAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTGA
It's finally published! The first polyploid reference genome for sugarcane cultivars. This is the most complex plant genome we have ever completed and a fantastic resource for sugarcane breeders and researchers! @hudsonalpha @jgi @BerkeleyLab @jbei
Sweet! Researchers have successfully sequenced sugarcane’s complex genetic code. This accurate genome will help researchers study disease resistance, compare plant species, and work toward better crops for biofuels. @jbei @jgi newscenter.lbl.gov/2024/03/27/swe…
A new study published in @CurrentBiology delves into the fascinating #Genetics behind #Bengal #Cats, provides some genetic surprises, and reveals some genetic secrets that underlie their unique appearance. @hudsonalpha eurekalert.org/news-releases/…
Trends for United States
You might like
